Incidental Mutation 'R8036:Crb1'
ID618215
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R8036 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139237384 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1062 (I1062V)
Ref Sequence ENSEMBL: ENSMUSP00000060769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000198445]
Predicted Effect probably benign
Transcript: ENSMUST00000059825
AA Change: I1062V

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: I1062V

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198445
AA Change: I1001V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: I1001V

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
R7020:Crb1 UTSW 1 139231603 missense possibly damaging 0.85
R7072:Crb1 UTSW 1 139237275 missense probably damaging 1.00
R7073:Crb1 UTSW 1 139248311 missense probably damaging 0.99
R7135:Crb1 UTSW 1 139243367 missense probably damaging 0.97
R7493:Crb1 UTSW 1 139237030 missense probably damaging 1.00
R7539:Crb1 UTSW 1 139248229 missense probably damaging 1.00
R7554:Crb1 UTSW 1 139337281 missense probably damaging 1.00
R7593:Crb1 UTSW 1 139237240 missense probably damaging 1.00
R7740:Crb1 UTSW 1 139237690 missense probably benign 0.01
R7912:Crb1 UTSW 1 139243171 missense probably damaging 1.00
R7993:Crb1 UTSW 1 139243171 missense probably damaging 1.00
R8042:Crb1 UTSW 1 139314654 missense probably damaging 0.99
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Z1176:Crb1 UTSW 1 139237086 frame shift probably null
Z1177:Crb1 UTSW 1 139237086 frame shift probably null
Z1177:Crb1 UTSW 1 139248901 missense possibly damaging 0.80
Z1177:Crb1 UTSW 1 139337028 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGGCTTACCAGGGAAAC -3'
(R):5'- GAGAACTCACCAATATCACATTTGC -3'

Sequencing Primer
(F):5'- CAACAGATTGGTCACCCA -3'
(R):5'- CACATTTGCTTTCAGAACACATG -3'
Posted On2020-01-23