Incidental Mutation 'R8036:Fam20b'
ID618216
Institutional Source Beutler Lab
Gene Symbol Fam20b
Ensembl Gene ENSMUSG00000033557
Gene Namefamily with sequence similarity 20, member B
SynonymsC530043G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location156678532-156719086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156705837 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 70 (W70R)
Ref Sequence ENSEMBL: ENSMUSP00000083322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086153] [ENSMUST00000122424]
Predicted Effect probably damaging
Transcript: ENSMUST00000086153
AA Change: W70R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083322
Gene: ENSMUSG00000033557
AA Change: W70R

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:Fam20C 188 399 3.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122424
AA Change: W70R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112534
Gene: ENSMUSG00000033557
AA Change: W70R

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:DUF1193 187 402 2e-95 PFAM
Meta Mutation Damage Score 0.7368 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with decreased embryo size, multisystem organ hypoplasia, and delayed skeleton, digestive system, eye, liver, and lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Fam20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Fam20b APN 1 156702465 missense probably benign 0.13
Cancelled UTSW 1 156705837 missense probably damaging 1.00
consequences UTSW 1 156690553 missense probably damaging 1.00
delisted UTSW 1 156690645 missense probably benign 0.18
Head_over_heels UTSW 1 156690570 missense probably damaging 1.00
minuscule UTSW 1 156705740 missense probably damaging 1.00
squirt UTSW 1 156705729 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0389:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0443:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0518:Fam20b UTSW 1 156687456 missense possibly damaging 0.70
R1466:Fam20b UTSW 1 156686188 splice site probably benign
R1584:Fam20b UTSW 1 156686188 splice site probably benign
R2014:Fam20b UTSW 1 156705941 missense possibly damaging 0.92
R4085:Fam20b UTSW 1 156705875 missense probably benign 0.01
R4755:Fam20b UTSW 1 156687496 nonsense probably null
R5254:Fam20b UTSW 1 156705740 missense probably damaging 1.00
R5471:Fam20b UTSW 1 156705729 missense probably damaging 1.00
R6886:Fam20b UTSW 1 156690511 missense probably damaging 1.00
R6944:Fam20b UTSW 1 156687521 missense probably benign 0.02
R7013:Fam20b UTSW 1 156690565 missense probably damaging 1.00
R7205:Fam20b UTSW 1 156702398 critical splice donor site probably null
R7215:Fam20b UTSW 1 156690553 missense probably damaging 1.00
R7286:Fam20b UTSW 1 156681442 missense probably benign 0.28
R7684:Fam20b UTSW 1 156690645 missense probably benign 0.18
R8119:Fam20b UTSW 1 156690502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAGACTCACCGCTTAGGC -3'
(R):5'- AAGAGGCCACCATGAAGCTG -3'

Sequencing Primer
(F):5'- TGAAGACTCACCGCTTAGGCTTAAAG -3'
(R):5'- CTGAAGCAGCGAGTTGTGC -3'
Posted On2020-01-23