Incidental Mutation 'R8036:Olfr248'
ID618218
Institutional Source Beutler Lab
Gene Symbol Olfr248
Ensembl Gene ENSMUSG00000059503
Gene Nameolfactory receptor 248
SynonymsGA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174391046-174392055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174391816 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 249 (H249R)
Ref Sequence ENSEMBL: ENSMUSP00000074799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075329]
Predicted Effect probably damaging
Transcript: ENSMUST00000075329
AA Change: H249R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074799
Gene: ENSMUSG00000059503
AA Change: H249R

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.2e-40 PFAM
Pfam:7tm_1 39 303 7.5e-22 PFAM
Meta Mutation Damage Score 0.3496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Olfr248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Olfr248 APN 1 174391408 missense probably damaging 1.00
R0375:Olfr248 UTSW 1 174391209 missense probably damaging 1.00
R1720:Olfr248 UTSW 1 174391920 missense probably benign 0.00
R1906:Olfr248 UTSW 1 174391164 missense probably damaging 1.00
R1996:Olfr248 UTSW 1 174391417 missense probably damaging 1.00
R2009:Olfr248 UTSW 1 174391429 missense possibly damaging 0.94
R4745:Olfr248 UTSW 1 174391876 missense probably damaging 1.00
R5294:Olfr248 UTSW 1 174391225 missense probably benign
R5297:Olfr248 UTSW 1 174391200 missense probably benign 0.21
R5665:Olfr248 UTSW 1 174391375 missense probably damaging 1.00
R5784:Olfr248 UTSW 1 174391399 missense probably damaging 1.00
R5857:Olfr248 UTSW 1 174391108 missense possibly damaging 0.59
R6943:Olfr248 UTSW 1 174391841 nonsense probably null
R6975:Olfr248 UTSW 1 174391677 missense probably benign 0.10
R7114:Olfr248 UTSW 1 174391239 missense probably damaging 0.96
R7614:Olfr248 UTSW 1 174391654 missense probably damaging 0.99
R8674:Olfr248 UTSW 1 174391692 missense probably damaging 1.00
R8777:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
R8777-TAIL:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTGCACAGACAGTAACTTC -3'
(R):5'- TGCTCCAGTGACTGATGAAAC -3'

Sequencing Primer
(F):5'- GCACAGACAGTAACTTCACAGAATTC -3'
(R):5'- GTCCTTATTCCTGAGTGTG -3'
Posted On2020-01-23