Incidental Mutation 'R0661:Usf1'
ID61822
Institutional Source Beutler Lab
Gene Symbol Usf1
Ensembl Gene ENSMUSG00000026641
Gene Nameupstream transcription factor 1
SynonymsbHLHb11, upstream stimulatory factor
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R0661 (G1)
Quality Score142
Status Not validated
Chromosome1
Chromosomal Location171411313-171419142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 171417499 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 196 (R196Q)
Ref Sequence ENSEMBL: ENSMUSP00000125363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546] [ENSMUST00000171362]
Predicted Effect probably benign
Transcript: ENSMUST00000001284
Predicted Effect probably benign
Transcript: ENSMUST00000159207
SMART Domains Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160335
Predicted Effect probably damaging
Transcript: ENSMUST00000160486
AA Change: R196Q

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641
AA Change: R196Q

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161241
AA Change: R196Q

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641
AA Change: R196Q

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161297
Predicted Effect possibly damaging
Transcript: ENSMUST00000167546
AA Change: R196Q

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641
AA Change: R196Q

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171362
SMART Domains Protein: ENSMUSP00000132771
Gene: ENSMUSG00000103711

DomainStartEndE-ValueType
RHOD 25 133 2.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194029
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mutants exhibit slight behavioral abnormalities. Females exhibit barbering and some have seizures. This knockout mutation (heterozygous or homozygous) acts as an enhancer of a null mutation of Usf2, resulting in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Usf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usf1 APN 1 171417275 missense probably damaging 0.98
IGL01658:Usf1 APN 1 171417299 missense possibly damaging 0.93
IGL01921:Usf1 APN 1 171416856 missense possibly damaging 0.94
IGL02307:Usf1 APN 1 171415746 missense probably damaging 0.99
R1075:Usf1 UTSW 1 171418109 missense probably benign 0.22
R1652:Usf1 UTSW 1 171417749 missense probably damaging 1.00
R2272:Usf1 UTSW 1 171418060 missense possibly damaging 0.60
R4697:Usf1 UTSW 1 171416964 missense possibly damaging 0.55
R4999:Usf1 UTSW 1 171415763 missense probably damaging 0.98
R5940:Usf1 UTSW 1 171417779 missense possibly damaging 0.95
R7430:Usf1 UTSW 1 171417727 missense probably benign
R7863:Usf1 UTSW 1 171417817 nonsense probably null
R7866:Usf1 UTSW 1 171417894 missense unknown
R7946:Usf1 UTSW 1 171417817 nonsense probably null
R7949:Usf1 UTSW 1 171417894 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTCATGTCGTCACAGGTCAATTC -3'
(R):5'- GCCGCAGCTCCTGGATATAATCAC -3'

Sequencing Primer
(F):5'- GATGTCACCACAAGAAGTATTGC -3'
(R):5'- AGGCTTTGGACAGGATTCCAC -3'
Posted On2013-07-30