Incidental Mutation 'R8036:Olfr1132'
ID618220
Institutional Source Beutler Lab
Gene Symbol Olfr1132
Ensembl Gene ENSMUSG00000068818
Gene Nameolfactory receptor 1132
SynonymsMOR177-1, GA_x6K02T2Q125-49140947-49140021
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87632583-87637535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87635503 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 81 (M81I)
Ref Sequence ENSEMBL: ENSMUSP00000149683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090711] [ENSMUST00000216082]
Predicted Effect probably benign
Transcript: ENSMUST00000090711
AA Change: M81I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088213
Gene: ENSMUSG00000068818
AA Change: M81I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-45 PFAM
Pfam:7tm_1 41 290 4.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216082
AA Change: M81I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Olfr1132
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Olfr1132 APN 2 87635384 missense probably damaging 1.00
IGL01780:Olfr1132 APN 2 87635080 missense possibly damaging 0.56
R1235:Olfr1132 UTSW 2 87634815 splice site probably null
R1471:Olfr1132 UTSW 2 87635670 missense probably benign
R2106:Olfr1132 UTSW 2 87635159 missense probably benign 0.22
R3711:Olfr1132 UTSW 2 87635681 missense probably benign
R4024:Olfr1132 UTSW 2 87635155 missense probably damaging 0.97
R4522:Olfr1132 UTSW 2 87635151 missense probably benign
R6531:Olfr1132 UTSW 2 87635529 missense probably damaging 1.00
R7768:Olfr1132 UTSW 2 87635313 missense probably benign
R8158:Olfr1132 UTSW 2 87634889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTCCAGCCATCAGGAGG -3'
(R):5'- GGAATTACCAAGAACCCTGACATG -3'

Sequencing Primer
(F):5'- CATCAGGAGGGAGCACAGCC -3'
(R):5'- GACATGAGAGTGACCTTCTTCAC -3'
Posted On2020-01-23