Incidental Mutation 'R8036:Foxa2'
ID618222
Institutional Source Beutler Lab
Gene Symbol Foxa2
Ensembl Gene ENSMUSG00000037025
Gene Nameforkhead box A2
SynonymsHnf-3b, Hnf3b, Tcf-3b, HNF3-beta, Tcf3b, HNF3beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148042877-148046969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 148043989 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 308 (T308S)
Ref Sequence ENSEMBL: ENSMUSP00000105590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047315] [ENSMUST00000109964] [ENSMUST00000172928]
Predicted Effect probably benign
Transcript: ENSMUST00000047315
AA Change: T302S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045918
Gene: ENSMUSG00000037025
AA Change: T302S

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 44 67 N/A INTRINSIC
low complexity region 74 104 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
FH 157 247 4.77e-62 SMART
low complexity region 262 281 N/A INTRINSIC
low complexity region 326 365 N/A INTRINSIC
Pfam:HNF_C 374 448 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109964
AA Change: T308S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105590
Gene: ENSMUSG00000037025
AA Change: T308S

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 50 73 N/A INTRINSIC
low complexity region 80 110 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
FH 163 253 4.77e-62 SMART
low complexity region 268 287 N/A INTRINSIC
low complexity region 332 371 N/A INTRINSIC
Pfam:HNF_C 380 454 5.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172928
AA Change: T127S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134081
Gene: ENSMUSG00000037025
AA Change: T127S

DomainStartEndE-ValueType
FH 13 72 1.94e-12 SMART
low complexity region 87 106 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
Pfam:HNF_C 199 273 4.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Embryos homozygous for targeted null mutations fail to form a distinct node, lack a notochord, and die by embryonic day 10 or 11. Mutants also exhibit defects of somite and neural tube organization, and lack a floor plate and motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Foxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Foxa2 APN 2 148044818 missense possibly damaging 0.93
IGL02560:Foxa2 APN 2 148044031 missense probably benign 0.40
IGL02797:Foxa2 APN 2 148044125 missense possibly damaging 0.95
R6768_Foxa2_027 UTSW 2 148043827 missense probably damaging 0.97
R0116:Foxa2 UTSW 2 148043561 missense probably damaging 0.99
R2252:Foxa2 UTSW 2 148044166 missense probably damaging 0.98
R4334:Foxa2 UTSW 2 148044703 missense possibly damaging 0.85
R5293:Foxa2 UTSW 2 148044002 missense probably benign 0.09
R5339:Foxa2 UTSW 2 148044434 missense probably damaging 1.00
R6768:Foxa2 UTSW 2 148043827 missense probably damaging 0.97
R8137:Foxa2 UTSW 2 148043848 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAAGGCGTAATGGTGCTC -3'
(R):5'- AACATGTTCGAGAACGGCTGC -3'

Sequencing Primer
(F):5'- AATGGTGCTCGGGCTTCAG -3'
(R):5'- TTCGAGAACGGCTGCTACCTG -3'
Posted On2020-01-23