Incidental Mutation 'R8036:Cenpe'
ID618224
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8036 (G1)
Quality Score162.468
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACTCTCT to ACTCT at 135239848 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
Predicted Effect probably null
Transcript: ENSMUST00000062893
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7926:Cenpe UTSW 3 135232959 nonsense probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCCAGTGAACAG -3'
(R):5'- AGTTCTAACTTAGGCAGAGACATC -3'

Sequencing Primer
(F):5'- GAACCCAAAGCTAGCTGTCTGTATG -3'
(R):5'- GACATCTGTCAAGTCATATAACCATC -3'
Posted On2020-01-23