Incidental Mutation 'R8036:Cenpe'
ID 618224
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, Kif10, N-7 kinesin, CENP-E
MMRRC Submission 067473-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8036 (G1)
Quality Score 162.468
Status Validated
Chromosome 3
Chromosomal Location 134918324-134979301 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) ACTCTCT to ACTCT at 134945609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062893
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,236,818 (GRCm39) V1473A possibly damaging Het
Akap9 T A 5: 4,120,397 (GRCm39) C3604* probably null Het
Alas1 A G 9: 106,112,721 (GRCm39) I545T probably benign Het
Anpep A C 7: 79,491,646 (GRCm39) D118E probably benign Het
Arhgef17 A T 7: 100,579,062 (GRCm39) S629T probably damaging Het
Arid2 C T 15: 96,266,625 (GRCm39) R558C probably damaging Het
Camk2n1 A G 4: 138,184,056 (GRCm39) D65G probably damaging Het
Ccdc177 T C 12: 80,804,897 (GRCm39) N459S unknown Het
Crb1 T C 1: 139,165,122 (GRCm39) I1062V probably benign Het
Decr2 A G 17: 26,301,962 (GRCm39) L256P probably damaging Het
Dhx37 T C 5: 125,501,739 (GRCm39) M507V probably benign Het
Disp1 A G 1: 182,870,803 (GRCm39) I539T probably damaging Het
Dqx1 T A 6: 83,036,788 (GRCm39) V264E probably damaging Het
Enpp4 A G 17: 44,413,136 (GRCm39) S133P possibly damaging Het
Fam149a T C 8: 45,802,048 (GRCm39) T476A probably benign Het
Fam20b A G 1: 156,533,407 (GRCm39) W70R probably damaging Het
Fbxl13 T A 5: 21,728,566 (GRCm39) N508Y probably damaging Het
Fjx1 A G 2: 102,280,720 (GRCm39) L405P probably damaging Het
Fn1 G A 1: 71,629,310 (GRCm39) Q2399* probably null Het
Foxa2 G C 2: 147,885,909 (GRCm39) T308S probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gm10521 A G 1: 171,723,752 (GRCm39) D21G unknown Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Herpud1 A G 8: 95,119,014 (GRCm39) E256G probably damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Kctd13 A G 7: 126,528,414 (GRCm39) D63G possibly damaging Het
Lamp3 C A 16: 19,519,809 (GRCm39) D125Y probably damaging Het
Luzp2 A G 7: 54,724,823 (GRCm39) D128G probably damaging Het
Lyve1 A G 7: 110,458,649 (GRCm39) C105R probably damaging Het
Mlkl A T 8: 112,060,086 (GRCm39) V100E probably damaging Het
Muc5b T C 7: 141,421,478 (GRCm39) S4323P possibly damaging Het
Myoz3 T G 18: 60,713,922 (GRCm39) probably null Het
Nlrp9c T A 7: 26,070,864 (GRCm39) N906Y possibly damaging Het
Odad1 A G 7: 45,592,276 (GRCm39) D352G probably benign Het
Or10x4 A G 1: 174,219,382 (GRCm39) H249R probably damaging Het
Or51f23 A T 7: 102,452,763 (GRCm39) H26L possibly damaging Het
Or8b49 T C 9: 38,506,186 (GRCm39) F223S probably benign Het
Or8w1 C T 2: 87,465,847 (GRCm39) M81I probably benign Het
Pcsk9 G A 4: 106,311,536 (GRCm39) H232Y possibly damaging Het
Plec A G 15: 76,063,380 (GRCm39) I2230T possibly damaging Het
Pou2f3 T A 9: 43,058,205 (GRCm39) T47S probably damaging Het
Rab8a A T 8: 72,928,439 (GRCm39) I106F probably damaging Het
Relch A T 1: 105,605,902 (GRCm39) I181F probably damaging Het
Ros1 A T 10: 52,041,439 (GRCm39) S295T probably benign Het
Sh3yl1 T A 12: 30,992,098 (GRCm39) N222K possibly damaging Het
Slc6a9 C T 4: 117,725,083 (GRCm39) A559V possibly damaging Het
Spata20 T G 11: 94,369,963 (GRCm39) I778L probably benign Het
Taar1 A T 10: 23,797,033 (GRCm39) T244S probably benign Het
Tmem229b C A 12: 79,011,862 (GRCm39) C23F probably damaging Het
Ttll4 A G 1: 74,718,389 (GRCm39) Y80C probably benign Het
Ube2m G A 7: 12,769,566 (GRCm39) T176I probably benign Het
Zfp790 G A 7: 29,528,346 (GRCm39) A344T possibly damaging Het
Zfp90 G A 8: 107,145,760 (GRCm39) V31M probably benign Het
Zswim4 C T 8: 84,949,918 (GRCm39) R659Q probably benign Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 134,937,216 (GRCm39) critical splice donor site probably null
IGL00799:Cenpe APN 3 134,934,678 (GRCm39) critical splice donor site probably null
IGL00815:Cenpe APN 3 134,965,112 (GRCm39) missense probably benign
IGL01446:Cenpe APN 3 134,943,300 (GRCm39) missense probably benign 0.01
IGL01469:Cenpe APN 3 134,934,567 (GRCm39) missense probably damaging 1.00
IGL01843:Cenpe APN 3 134,924,268 (GRCm39) missense possibly damaging 0.88
IGL02254:Cenpe APN 3 134,961,238 (GRCm39) missense probably benign
IGL02337:Cenpe APN 3 134,926,037 (GRCm39) splice site probably benign
IGL02382:Cenpe APN 3 134,953,147 (GRCm39) missense probably benign
IGL02458:Cenpe APN 3 134,935,869 (GRCm39) nonsense probably null
IGL02934:Cenpe APN 3 134,970,112 (GRCm39) missense probably damaging 1.00
IGL03335:Cenpe APN 3 134,949,386 (GRCm39) missense probably benign
R0086:Cenpe UTSW 3 134,970,185 (GRCm39) splice site probably benign
R0173:Cenpe UTSW 3 134,965,744 (GRCm39) missense probably benign 0.00
R0394:Cenpe UTSW 3 134,922,186 (GRCm39) splice site probably benign
R0411:Cenpe UTSW 3 134,928,016 (GRCm39) missense probably damaging 1.00
R0624:Cenpe UTSW 3 134,952,347 (GRCm39) missense probably benign 0.00
R0634:Cenpe UTSW 3 134,952,588 (GRCm39) missense probably damaging 1.00
R0648:Cenpe UTSW 3 134,935,843 (GRCm39) missense probably damaging 1.00
R0691:Cenpe UTSW 3 134,923,066 (GRCm39) missense probably damaging 1.00
R1184:Cenpe UTSW 3 134,970,183 (GRCm39) critical splice donor site probably null
R1530:Cenpe UTSW 3 134,952,663 (GRCm39) missense possibly damaging 0.92
R1559:Cenpe UTSW 3 134,976,661 (GRCm39) missense probably benign 0.07
R1562:Cenpe UTSW 3 134,944,155 (GRCm39) missense possibly damaging 0.53
R1568:Cenpe UTSW 3 134,945,519 (GRCm39) missense probably benign 0.01
R1712:Cenpe UTSW 3 134,971,694 (GRCm39) missense probably damaging 0.99
R1828:Cenpe UTSW 3 134,952,257 (GRCm39) missense probably damaging 0.99
R1846:Cenpe UTSW 3 134,945,606 (GRCm39) missense probably damaging 1.00
R1861:Cenpe UTSW 3 134,974,740 (GRCm39) missense probably damaging 1.00
R1938:Cenpe UTSW 3 134,953,240 (GRCm39) missense probably damaging 0.98
R1961:Cenpe UTSW 3 134,948,254 (GRCm39) missense probably damaging 1.00
R2062:Cenpe UTSW 3 134,928,082 (GRCm39) splice site probably benign
R2118:Cenpe UTSW 3 134,952,645 (GRCm39) missense possibly damaging 0.94
R2127:Cenpe UTSW 3 134,945,541 (GRCm39) missense probably benign 0.08
R2156:Cenpe UTSW 3 134,953,235 (GRCm39) missense probably benign 0.34
R2265:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2268:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2392:Cenpe UTSW 3 134,953,874 (GRCm39) missense probably damaging 1.00
R2508:Cenpe UTSW 3 134,946,834 (GRCm39) missense possibly damaging 0.92
R3084:Cenpe UTSW 3 134,946,782 (GRCm39) missense probably damaging 1.00
R3779:Cenpe UTSW 3 134,962,337 (GRCm39) missense possibly damaging 0.87
R3833:Cenpe UTSW 3 134,928,083 (GRCm39) splice site probably benign
R3974:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R3975:Cenpe UTSW 3 134,944,233 (GRCm39) critical splice donor site probably null
R3975:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R4151:Cenpe UTSW 3 134,920,914 (GRCm39) missense probably benign 0.36
R4166:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R4581:Cenpe UTSW 3 134,952,761 (GRCm39) missense probably benign 0.30
R4622:Cenpe UTSW 3 134,949,469 (GRCm39) missense probably benign 0.22
R4692:Cenpe UTSW 3 134,922,140 (GRCm39) missense probably benign 0.29
R4769:Cenpe UTSW 3 134,953,912 (GRCm39) missense probably benign
R4976:Cenpe UTSW 3 134,940,637 (GRCm39) missense probably damaging 1.00
R4983:Cenpe UTSW 3 134,940,689 (GRCm39) missense probably damaging 1.00
R4990:Cenpe UTSW 3 134,962,401 (GRCm39) missense probably damaging 1.00
R5002:Cenpe UTSW 3 134,952,842 (GRCm39) missense probably benign
R5057:Cenpe UTSW 3 134,926,074 (GRCm39) missense probably benign 0.14
R5063:Cenpe UTSW 3 134,976,715 (GRCm39) missense probably damaging 0.99
R5181:Cenpe UTSW 3 134,948,064 (GRCm39) missense probably damaging 0.99
R5281:Cenpe UTSW 3 134,935,911 (GRCm39) missense possibly damaging 0.89
R5389:Cenpe UTSW 3 134,965,149 (GRCm39) critical splice donor site probably null
R5517:Cenpe UTSW 3 134,929,026 (GRCm39) missense probably damaging 1.00
R5521:Cenpe UTSW 3 134,974,826 (GRCm39) missense probably damaging 1.00
R5607:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5608:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5627:Cenpe UTSW 3 134,941,234 (GRCm39) missense possibly damaging 0.51
R5766:Cenpe UTSW 3 134,954,174 (GRCm39) missense probably damaging 0.96
R5783:Cenpe UTSW 3 134,967,341 (GRCm39) missense probably benign 0.00
R5933:Cenpe UTSW 3 134,967,389 (GRCm39) missense probably benign 0.03
R6073:Cenpe UTSW 3 134,965,834 (GRCm39) nonsense probably null
R6163:Cenpe UTSW 3 134,974,764 (GRCm39) missense probably damaging 0.99
R6192:Cenpe UTSW 3 134,954,291 (GRCm39) missense possibly damaging 0.93
R6224:Cenpe UTSW 3 134,949,536 (GRCm39) missense possibly damaging 0.87
R6313:Cenpe UTSW 3 134,935,936 (GRCm39) missense probably benign 0.26
R6326:Cenpe UTSW 3 134,945,539 (GRCm39) missense probably benign 0.15
R6383:Cenpe UTSW 3 134,957,289 (GRCm39) missense probably damaging 1.00
R6418:Cenpe UTSW 3 134,957,305 (GRCm39) missense probably damaging 0.99
R6797:Cenpe UTSW 3 134,943,899 (GRCm39) missense possibly damaging 0.92
R6810:Cenpe UTSW 3 134,949,583 (GRCm39) missense probably benign 0.00
R6989:Cenpe UTSW 3 134,940,888 (GRCm39) missense probably damaging 1.00
R7009:Cenpe UTSW 3 134,940,963 (GRCm39) missense probably benign 0.02
R7009:Cenpe UTSW 3 134,940,962 (GRCm39) missense probably damaging 0.97
R7039:Cenpe UTSW 3 134,961,217 (GRCm39) missense probably benign 0.28
R7387:Cenpe UTSW 3 134,952,798 (GRCm39) missense probably benign 0.05
R7470:Cenpe UTSW 3 134,947,916 (GRCm39) missense probably damaging 1.00
R7535:Cenpe UTSW 3 134,949,523 (GRCm39) missense possibly damaging 0.90
R7562:Cenpe UTSW 3 134,954,395 (GRCm39) missense probably damaging 1.00
R7573:Cenpe UTSW 3 134,953,220 (GRCm39) missense probably damaging 1.00
R7613:Cenpe UTSW 3 134,948,063 (GRCm39) missense possibly damaging 0.90
R7741:Cenpe UTSW 3 134,953,096 (GRCm39) splice site probably null
R7771:Cenpe UTSW 3 134,946,702 (GRCm39) splice site probably null
R7843:Cenpe UTSW 3 134,938,720 (GRCm39) nonsense probably null
R7973:Cenpe UTSW 3 134,929,011 (GRCm39) missense probably damaging 1.00
R8069:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R8151:Cenpe UTSW 3 134,952,783 (GRCm39) missense probably benign 0.28
R8176:Cenpe UTSW 3 134,935,851 (GRCm39) missense probably damaging 1.00
R8191:Cenpe UTSW 3 134,957,375 (GRCm39) missense probably benign
R8251:Cenpe UTSW 3 134,957,445 (GRCm39) critical splice donor site probably null
R8425:Cenpe UTSW 3 134,948,388 (GRCm39) nonsense probably null
R8488:Cenpe UTSW 3 134,965,002 (GRCm39) missense probably damaging 1.00
R8811:Cenpe UTSW 3 134,929,001 (GRCm39) missense probably damaging 1.00
R8850:Cenpe UTSW 3 134,930,777 (GRCm39) missense probably damaging 1.00
R8879:Cenpe UTSW 3 134,965,862 (GRCm39) missense probably damaging 0.99
R8899:Cenpe UTSW 3 134,945,644 (GRCm39) missense probably benign 0.18
R9035:Cenpe UTSW 3 134,976,572 (GRCm39) missense probably benign 0.01
R9038:Cenpe UTSW 3 134,923,797 (GRCm39) missense probably benign 0.00
R9093:Cenpe UTSW 3 134,945,641 (GRCm39) nonsense probably null
R9221:Cenpe UTSW 3 134,935,839 (GRCm39) missense possibly damaging 0.90
R9365:Cenpe UTSW 3 134,954,207 (GRCm39) missense possibly damaging 0.56
R9443:Cenpe UTSW 3 134,976,609 (GRCm39) missense probably damaging 0.99
Z1177:Cenpe UTSW 3 134,922,146 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCCAGTGAACAG -3'
(R):5'- AGTTCTAACTTAGGCAGAGACATC -3'

Sequencing Primer
(F):5'- GAACCCAAAGCTAGCTGTCTGTATG -3'
(R):5'- GACATCTGTCAAGTCATATAACCATC -3'
Posted On 2020-01-23