Incidental Mutation 'R0661:Yme1l1'
ID 61823
Institutional Source Beutler Lab
Gene Symbol Yme1l1
Ensembl Gene ENSMUSG00000026775
Gene Name YME1-like 1 (S. cerevisiae)
Synonyms ATP-dependent metalloprotease FtsH1, Ftsh
MMRRC Submission 038846-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R0661 (G1)
Quality Score 126
Status Not validated
Chromosome 2
Chromosomal Location 23156369-23199260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23191042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 442 (M442K)
Ref Sequence ENSEMBL: ENSMUSP00000028117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028117]
AlphaFold O88967
Predicted Effect probably damaging
Transcript: ENSMUST00000028117
AA Change: M442K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775
AA Change: M442K

DomainStartEndE-ValueType
AAA 313 450 4.77e-23 SMART
Pfam:Peptidase_M41 508 706 5.8e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134342
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null embryos die prior to E13.5, and show a developmental delay from E8.5 to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Yme1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Yme1l1 APN 2 23192500 missense probably benign 0.00
IGL01764:Yme1l1 APN 2 23162544 missense probably benign 0.00
IGL03289:Yme1l1 APN 2 23160268 missense probably benign
R0043:Yme1l1 UTSW 2 23187803 missense probably damaging 0.97
R0540:Yme1l1 UTSW 2 23192515 missense possibly damaging 0.68
R0583:Yme1l1 UTSW 2 23186250 missense probably damaging 1.00
R0673:Yme1l1 UTSW 2 23168288 missense probably benign 0.03
R2154:Yme1l1 UTSW 2 23162508 missense probably damaging 0.99
R2241:Yme1l1 UTSW 2 23196900 nonsense probably null
R2270:Yme1l1 UTSW 2 23175220 missense possibly damaging 0.53
R2345:Yme1l1 UTSW 2 23194786 missense probably damaging 1.00
R3837:Yme1l1 UTSW 2 23191080 missense possibly damaging 0.69
R4344:Yme1l1 UTSW 2 23173061 missense probably benign 0.02
R4368:Yme1l1 UTSW 2 23160211 missense possibly damaging 0.81
R4412:Yme1l1 UTSW 2 23175187 missense probably damaging 1.00
R4470:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4472:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4934:Yme1l1 UTSW 2 23168321 nonsense probably null
R5033:Yme1l1 UTSW 2 23194747 missense probably damaging 1.00
R5388:Yme1l1 UTSW 2 23162557 missense probably benign 0.01
R5389:Yme1l1 UTSW 2 23193234 missense probably damaging 1.00
R5943:Yme1l1 UTSW 2 23168330 missense probably damaging 0.96
R5947:Yme1l1 UTSW 2 23195306 intron probably benign
R6243:Yme1l1 UTSW 2 23193172 missense probably benign 0.00
R6724:Yme1l1 UTSW 2 23194762 missense probably damaging 1.00
R6891:Yme1l1 UTSW 2 23195389 missense probably damaging 0.99
R7016:Yme1l1 UTSW 2 23186355 splice site probably null
R7565:Yme1l1 UTSW 2 23160220 missense possibly damaging 0.88
R7589:Yme1l1 UTSW 2 23160262 missense probably benign 0.01
R7751:Yme1l1 UTSW 2 23187844 critical splice donor site probably null
R7871:Yme1l1 UTSW 2 23181065 missense probably damaging 1.00
R7909:Yme1l1 UTSW 2 23194757 missense probably benign 0.00
R8203:Yme1l1 UTSW 2 23164526 missense probably benign 0.00
R8329:Yme1l1 UTSW 2 23164585 nonsense probably null
R8474:Yme1l1 UTSW 2 23162572 missense probably benign
R8746:Yme1l1 UTSW 2 23162531 missense probably benign 0.05
R9154:Yme1l1 UTSW 2 23187803 missense probably damaging 1.00
R9159:Yme1l1 UTSW 2 23173046 missense probably damaging 1.00
R9361:Yme1l1 UTSW 2 23191051 missense possibly damaging 0.93
Z1176:Yme1l1 UTSW 2 23162517 missense probably damaging 0.96
Z1176:Yme1l1 UTSW 2 23193184 missense probably damaging 0.98
Z1177:Yme1l1 UTSW 2 23186877 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAGCCTTGACTTATGACTTCTGACC -3'
(R):5'- CCCCAAACCAAATTTCCTTTGGAATCG -3'

Sequencing Primer
(F):5'- GACTTCTGACCTTCTGAGGGAAC -3'
(R):5'- acacacacacacacacacc -3'
Posted On 2013-07-30