Incidental Mutation 'R8036:Dhx37'
ID618231
Institutional Source Beutler Lab
Gene Symbol Dhx37
Ensembl Gene ENSMUSG00000029480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 37
SynonymsLOC381671, LOC208144
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location125413858-125434121 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125424675 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 507 (M507V)
Ref Sequence ENSEMBL: ENSMUSP00000131734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169485]
Predicted Effect probably benign
Transcript: ENSMUST00000169485
AA Change: M507V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131734
Gene: ENSMUSG00000029480
AA Change: M507V

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
DEXDc 246 438 3.55e-27 SMART
AAA 263 463 9.3e-3 SMART
HELICc 554 669 1.56e-14 SMART
Blast:DEXDc 678 717 1e-10 BLAST
HA2 729 852 3.32e-25 SMART
Pfam:OB_NTP_bind 886 1004 1.1e-25 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Dhx37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Dhx37 APN 5 125419088 missense possibly damaging 0.84
IGL02010:Dhx37 APN 5 125418713 missense possibly damaging 0.58
IGL02412:Dhx37 APN 5 125431628 missense probably damaging 0.98
IGL02484:Dhx37 APN 5 125419337 missense possibly damaging 0.89
IGL02986:Dhx37 APN 5 125419315 missense probably damaging 1.00
FR4304:Dhx37 UTSW 5 125427530 unclassified probably benign
R0010:Dhx37 UTSW 5 125431616 missense probably benign 0.02
R0019:Dhx37 UTSW 5 125430034 missense probably benign 0.36
R0485:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R0959:Dhx37 UTSW 5 125423432 missense probably benign
R1101:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R1132:Dhx37 UTSW 5 125421039 missense probably damaging 0.96
R1309:Dhx37 UTSW 5 125417438 nonsense probably null
R1777:Dhx37 UTSW 5 125429931 missense probably benign
R2001:Dhx37 UTSW 5 125427464 missense probably damaging 1.00
R2116:Dhx37 UTSW 5 125421102 missense probably damaging 0.98
R3826:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3829:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3830:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R4007:Dhx37 UTSW 5 125424931 splice site probably benign
R5058:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R5158:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R5436:Dhx37 UTSW 5 125429803 missense probably benign
R5789:Dhx37 UTSW 5 125421039 missense possibly damaging 0.55
R5834:Dhx37 UTSW 5 125425730 missense probably damaging 1.00
R6066:Dhx37 UTSW 5 125424666 missense probably benign 0.18
R6490:Dhx37 UTSW 5 125419132 missense probably benign 0.00
R6967:Dhx37 UTSW 5 125422167 missense probably benign 0.07
R7101:Dhx37 UTSW 5 125424942 nonsense probably null
Z1088:Dhx37 UTSW 5 125416591 missense possibly damaging 0.72
Z1177:Dhx37 UTSW 5 125424980 missense possibly damaging 0.81
Z1177:Dhx37 UTSW 5 125425472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCTAGAATTGTAATCCACCAGG -3'
(R):5'- CTACACATAGCCTCCTGTCG -3'

Sequencing Primer
(F):5'- ACCAGGACTCTGCTGTGGAAC -3'
(R):5'- CAACTGGTGCCCTGATTGG -3'
Posted On2020-01-23