Incidental Mutation 'R8036:Ccdc114'
ID618236
Institutional Source Beutler Lab
Gene Symbol Ccdc114
Ensembl Gene ENSMUSG00000040189
Gene Namecoiled-coil domain containing 114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45924072-45948963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45942852 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 352 (D352G)
Ref Sequence ENSEMBL: ENSMUSP00000042772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000210867]
Predicted Effect probably benign
Transcript: ENSMUST00000038720
AA Change: D352G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189
AA Change: D352G

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210867
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Ccdc114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ccdc114 APN 7 45942656 missense probably damaging 1.00
IGL01383:Ccdc114 APN 7 45939700 missense probably damaging 1.00
IGL01826:Ccdc114 APN 7 45948386 missense possibly damaging 0.62
R0865:Ccdc114 UTSW 7 45942088 missense probably benign 0.17
R1061:Ccdc114 UTSW 7 45941755 missense probably damaging 0.96
R1217:Ccdc114 UTSW 7 45942758 splice site probably benign
R1533:Ccdc114 UTSW 7 45942858 missense probably benign 0.00
R2863:Ccdc114 UTSW 7 45948312 missense probably benign 0.04
R3954:Ccdc114 UTSW 7 45941676 missense probably damaging 1.00
R4774:Ccdc114 UTSW 7 45948380 missense probably damaging 0.99
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4952:Ccdc114 UTSW 7 45942191 missense probably damaging 1.00
R5074:Ccdc114 UTSW 7 45929090 missense probably benign 0.05
R5187:Ccdc114 UTSW 7 45929116 missense probably damaging 1.00
R5265:Ccdc114 UTSW 7 45947435 missense probably damaging 1.00
R5364:Ccdc114 UTSW 7 45936332 missense probably damaging 0.99
R5377:Ccdc114 UTSW 7 45942082 nonsense probably null
R6221:Ccdc114 UTSW 7 45947479 missense probably damaging 1.00
R6246:Ccdc114 UTSW 7 45936364 missense probably damaging 1.00
R6324:Ccdc114 UTSW 7 45941710 missense probably damaging 1.00
R6389:Ccdc114 UTSW 7 45948516 missense probably benign 0.32
R6542:Ccdc114 UTSW 7 45948390 missense probably benign 0.00
R6593:Ccdc114 UTSW 7 45947384 missense probably damaging 0.96
R7215:Ccdc114 UTSW 7 45936622 missense probably damaging 1.00
R7401:Ccdc114 UTSW 7 45942765 missense probably damaging 1.00
R7431:Ccdc114 UTSW 7 45929246 missense probably damaging 0.99
R7725:Ccdc114 UTSW 7 45948411 missense probably damaging 0.98
R7878:Ccdc114 UTSW 7 45924560 missense possibly damaging 0.91
R8681:Ccdc114 UTSW 7 45941839 missense probably damaging 0.96
R8686:Ccdc114 UTSW 7 45947692 missense probably benign 0.20
X0064:Ccdc114 UTSW 7 45948393 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGAGATACACCACCTTCAGG -3'
(R):5'- AGCAAACGCGTAATGCCTTC -3'

Sequencing Primer
(F):5'- AGGTGAGCAAGGCCCAC -3'
(R):5'- TCATGGCCAGCTCCCCAC -3'
Posted On2020-01-23