Incidental Mutation 'R0661:Cdk9'
List |< first << previous [record 8 of 42] next >> last >|
ID61824
Institutional Source Beutler Lab
Gene Symbol Cdk9
Ensembl Gene ENSMUSG00000009555
Gene Namecyclin-dependent kinase 9 (CDC2-related kinase)
SynonymsPITALRE
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0661 (G1)
Quality Score115
Status Not validated
Chromosome2
Chromosomal Location32705784-32713076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32709820 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 135 (T135I)
Ref Sequence ENSEMBL: ENSMUSP00000113327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009699] [ENSMUST00000120105] [ENSMUST00000123170] [ENSMUST00000154131] [ENSMUST00000155205]
Predicted Effect probably damaging
Transcript: ENSMUST00000009699
AA Change: T186I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009699
Gene: ENSMUSG00000009555
AA Change: T186I

DomainStartEndE-ValueType
S_TKc 19 315 9.28e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120105
AA Change: T135I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113327
Gene: ENSMUSG00000009555
AA Change: T135I

DomainStartEndE-ValueType
Pfam:Pkinase 1 264 9.8e-58 PFAM
Pfam:Pkinase_Tyr 2 215 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144210
Predicted Effect probably benign
Transcript: ENSMUST00000154131
SMART Domains Protein: ENSMUSP00000120857
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 19 61 8.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155205
SMART Domains Protein: ENSMUSP00000115299
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 1 54 8.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198213
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Cdk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Cdk9 APN 2 32708051 missense possibly damaging 0.77
R0321:Cdk9 UTSW 2 32712686 unclassified probably benign
R0615:Cdk9 UTSW 2 32709801 missense possibly damaging 0.92
R0624:Cdk9 UTSW 2 32709824 missense probably damaging 1.00
R1525:Cdk9 UTSW 2 32710509 missense probably damaging 0.97
R2082:Cdk9 UTSW 2 32709501 missense probably damaging 1.00
R4416:Cdk9 UTSW 2 32708072 missense probably damaging 1.00
R6047:Cdk9 UTSW 2 32708273 splice site probably null
R7391:Cdk9 UTSW 2 32712071 missense probably damaging 0.96
R8127:Cdk9 UTSW 2 32707997 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATCTCTGCCATGATGCACCC -3'
(R):5'- CCAGGCTCCAGGATGCTATGAAAC -3'

Sequencing Primer
(F):5'- GAGTGCCTCTTAAGCCCAAG -3'
(R):5'- TGCTATGAAACCTGACTGAGC -3'
Posted On2013-07-30