Incidental Mutation 'R8036:Arhgef17'
ID 618240
Institutional Source Beutler Lab
Gene Symbol Arhgef17
Ensembl Gene ENSMUSG00000032875
Gene Name Rho guanine nucleotide exchange factor (GEF) 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8036 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 100869752-100932107 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100929855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 629 (S629T)
Ref Sequence ENSEMBL: ENSMUSP00000102647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107032]
AlphaFold Q80U35
Predicted Effect probably damaging
Transcript: ENSMUST00000107032
AA Change: S629T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: S629T

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 227 255 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 507 526 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
RhoGEF 1063 1246 9.56e-61 SMART
Blast:PH 1281 1466 4e-88 BLAST
low complexity region 1582 1595 N/A INTRINSIC
low complexity region 1630 1642 N/A INTRINSIC
low complexity region 1646 1657 N/A INTRINSIC
low complexity region 1661 1701 N/A INTRINSIC
low complexity region 1708 1719 N/A INTRINSIC
low complexity region 2033 2040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Arhgef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Arhgef17 APN 7 100929449 missense probably benign
IGL01071:Arhgef17 APN 7 100885700 missense probably damaging 0.99
IGL01882:Arhgef17 APN 7 100878580 nonsense probably null
IGL01995:Arhgef17 APN 7 100928655 missense probably benign 0.02
IGL02213:Arhgef17 APN 7 100890426 missense probably benign
IGL02380:Arhgef17 APN 7 100929443 missense possibly damaging 0.60
IGL02551:Arhgef17 APN 7 100930346 missense probably damaging 1.00
IGL02613:Arhgef17 APN 7 100928896 missense probably damaging 1.00
IGL02643:Arhgef17 APN 7 100883882 missense possibly damaging 0.95
IGL02798:Arhgef17 APN 7 100929626 missense probably benign 0.00
IGL03113:Arhgef17 APN 7 100929731 missense probably benign 0.00
IGL03264:Arhgef17 APN 7 100880013 missense probably benign 0.00
G1Funyon:Arhgef17 UTSW 7 100879659 missense probably benign 0.00
R0064:Arhgef17 UTSW 7 100881354 missense probably benign 0.00
R0189:Arhgef17 UTSW 7 100928850 missense probably damaging 1.00
R0482:Arhgef17 UTSW 7 100880621 missense probably damaging 1.00
R0826:Arhgef17 UTSW 7 100930743 missense probably benign 0.01
R1295:Arhgef17 UTSW 7 100881269 nonsense probably null
R1296:Arhgef17 UTSW 7 100881269 nonsense probably null
R1389:Arhgef17 UTSW 7 100931037 small deletion probably benign
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1513:Arhgef17 UTSW 7 100930862 missense probably benign
R1539:Arhgef17 UTSW 7 100890473 missense probably damaging 1.00
R1644:Arhgef17 UTSW 7 100929504 missense probably damaging 1.00
R1789:Arhgef17 UTSW 7 100929870 missense probably damaging 1.00
R1861:Arhgef17 UTSW 7 100882268 missense probably damaging 1.00
R1868:Arhgef17 UTSW 7 100878977 missense probably benign
R2009:Arhgef17 UTSW 7 100881781 missense probably damaging 0.98
R2095:Arhgef17 UTSW 7 100881263 missense probably damaging 1.00
R2311:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
R3607:Arhgef17 UTSW 7 100931172 missense probably damaging 1.00
R3882:Arhgef17 UTSW 7 100876454 missense possibly damaging 0.70
R4089:Arhgef17 UTSW 7 100883799 missense probably damaging 1.00
R4420:Arhgef17 UTSW 7 100882308 splice site probably benign
R4536:Arhgef17 UTSW 7 100929854 missense probably damaging 1.00
R4548:Arhgef17 UTSW 7 100931129 missense possibly damaging 0.60
R4616:Arhgef17 UTSW 7 100882485 missense probably damaging 1.00
R5040:Arhgef17 UTSW 7 100876825 missense probably benign 0.17
R5100:Arhgef17 UTSW 7 100881756 missense possibly damaging 0.90
R5233:Arhgef17 UTSW 7 100881369 missense possibly damaging 0.61
R5307:Arhgef17 UTSW 7 100929428 missense probably benign 0.00
R5313:Arhgef17 UTSW 7 100928924 missense probably damaging 0.99
R5643:Arhgef17 UTSW 7 100880011 missense probably damaging 1.00
R5704:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6166:Arhgef17 UTSW 7 100876492 missense probably damaging 1.00
R6417:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6420:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6510:Arhgef17 UTSW 7 100878536 missense probably damaging 0.97
R6877:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6888:Arhgef17 UTSW 7 100930820 missense possibly damaging 0.74
R7016:Arhgef17 UTSW 7 100878977 missense probably benign
R7073:Arhgef17 UTSW 7 100929991 nonsense probably null
R7322:Arhgef17 UTSW 7 100877797 missense probably benign 0.01
R7691:Arhgef17 UTSW 7 100929642 missense probably damaging 1.00
R7724:Arhgef17 UTSW 7 100880609 missense probably damaging 1.00
R7728:Arhgef17 UTSW 7 100930068 missense probably benign 0.00
R7829:Arhgef17 UTSW 7 100876845 missense probably benign 0.03
R8072:Arhgef17 UTSW 7 100881797 missense probably benign 0.04
R8301:Arhgef17 UTSW 7 100879659 missense probably benign 0.00
R8935:Arhgef17 UTSW 7 100878117 missense probably benign 0.03
R8958:Arhgef17 UTSW 7 100929812 missense probably damaging 0.98
R9221:Arhgef17 UTSW 7 100879611 missense possibly damaging 0.78
R9362:Arhgef17 UTSW 7 100930958 missense probably benign 0.12
R9499:Arhgef17 UTSW 7 100876895 missense possibly damaging 0.52
R9593:Arhgef17 UTSW 7 100882802 missense probably damaging 1.00
X0012:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CTGAAGGTGGCACTTTTCGTCTC -3'
(R):5'- AGAGGAAGACCCATTGCCAC -3'

Sequencing Primer
(F):5'- TCTCAGGAGACACAAGGGCC -3'
(R):5'- CACTCGTGGTCCAGGATCAGTATG -3'
Posted On 2020-01-23