Mutagenetix > Incidental Mutation

Incidental Mutation 'R8036:Arhgef17'

618240

Institutional Source

Beutler Lab

Gene Symbol

Arhgef17

Ensembl Gene

ENSMUSG00000032875

Gene Name

Rho guanine nucleotide exchange factor (GEF) 17

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8036 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100869752-100932107 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100929855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 629 (S629T)

Ref Sequence

ENSEMBL: ENSMUSP00000102647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107032]

AlphaFold

Q80U35

Predicted Effect

probably damaging
Transcript: ENSMUST00000107032
AA Change: S629T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: S629T

Domain	Start	End	E-Value	Type
low complexity region	65	74	N/A	INTRINSIC
low complexity region	160	175	N/A	INTRINSIC
low complexity region	196	209	N/A	INTRINSIC
low complexity region	227	255	N/A	INTRINSIC
low complexity region	282	297	N/A	INTRINSIC
low complexity region	314	323	N/A	INTRINSIC
low complexity region	507	526	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC
low complexity region	828	842	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
RhoGEF	1063	1246	9.56e-61	SMART
Blast:PH	1281	1466	4e-88	BLAST
low complexity region	1582	1595	N/A	INTRINSIC
low complexity region	1630	1642	N/A	INTRINSIC
low complexity region	1646	1657	N/A	INTRINSIC
low complexity region	1661	1701	N/A	INTRINSIC
low complexity region	1708	1719	N/A	INTRINSIC
low complexity region	2033	2040	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	T	1: 105,678,177	I181F	probably damaging	Het
Abcc3	A	G	11: 94,345,992	V1473A	possibly damaging	Het
Akap9	T	A	5: 4,070,397	C3604*	probably null	Het
Alas1	A	G	9: 106,235,522	I545T	probably benign	Het
Anpep	A	C	7: 79,841,898	D118E	probably benign	Het
Arid2	C	T	15: 96,368,744	R558C	probably damaging	Het
Camk2n1	A	G	4: 138,456,745	D65G	probably damaging	Het
Ccdc114	A	G	7: 45,942,852	D352G	probably benign	Het
Ccdc177	T	C	12: 80,758,123	N459S	unknown	Het
Cenpe	ACTCTCT	ACTCT	3: 135,239,848		probably null	Het
Crb1	T	C	1: 139,237,384	I1062V	probably benign	Het
Decr2	A	G	17: 26,082,988	L256P	probably damaging	Het
Dhx37	T	C	5: 125,424,675	M507V	probably benign	Het
Disp1	A	G	1: 183,089,239	I539T	probably damaging	Het
Dqx1	T	A	6: 83,059,807	V264E	probably damaging	Het
Enpp4	A	G	17: 44,102,245	S133P	possibly damaging	Het
Fam149a	T	C	8: 45,349,011	T476A	probably benign	Het
Fam20b	A	G	1: 156,705,837	W70R	probably damaging	Het
Fbxl13	T	A	5: 21,523,568	N508Y	probably damaging	Het
Fjx1	A	G	2: 102,450,375	L405P	probably damaging	Het
Fn1	G	A	1: 71,590,151	Q2399*	probably null	Het
Foxa2	G	C	2: 148,043,989	T308S	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gm10521	A	G	1: 171,896,185	D21G	unknown	Het
Gstcd	C	T	3: 133,082,107	V277M	probably damaging	Het
Herpud1	A	G	8: 94,392,386	E256G	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Kctd13	A	G	7: 126,929,242	D63G	possibly damaging	Het
Lamp3	C	A	16: 19,701,059	D125Y	probably damaging	Het
Luzp2	A	G	7: 55,075,075	D128G	probably damaging	Het
Lyve1	A	G	7: 110,859,442	C105R	probably damaging	Het
Mlkl	A	T	8: 111,333,454	V100E	probably damaging	Het
Muc5b	T	C	7: 141,867,741	S4323P	possibly damaging	Het
Myoz3	T	G	18: 60,580,850		probably null	Het
Nlrp9c	T	A	7: 26,371,439	N906Y	possibly damaging	Het
Olfr1132	C	T	2: 87,635,503	M81I	probably benign	Het
Olfr248	A	G	1: 174,391,816	H249R	probably damaging	Het
Olfr564	A	T	7: 102,803,556	H26L	possibly damaging	Het
Olfr913	T	C	9: 38,594,890	F223S	probably benign	Het
Pcsk9	G	A	4: 106,454,339	H232Y	possibly damaging	Het
Plec	A	G	15: 76,179,180	I2230T	possibly damaging	Het
Pou2f3	T	A	9: 43,146,908	T47S	probably damaging	Het
Rab8a	A	T	8: 72,174,595	I106F	probably damaging	Het
Ros1	A	T	10: 52,165,343	S295T	probably benign	Het
Sh3yl1	T	A	12: 30,942,099	N222K	possibly damaging	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Spata20	T	G	11: 94,479,137	I778L	probably benign	Het
Taar1	A	T	10: 23,921,135	T244S	probably benign	Het
Tmem229b	C	A	12: 78,965,088	C23F	probably damaging	Het
Ttll4	A	G	1: 74,679,230	Y80C	probably benign	Het
Ube2m	G	A	7: 13,035,639	T176I	probably benign	Het
Zfp790	G	A	7: 29,828,921	A344T	possibly damaging	Het
Zfp90	G	A	8: 106,419,128	V31M	probably benign	Het
Zswim4	C	T	8: 84,223,289	R659Q	probably benign	Het

Other mutations in Arhgef17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Arhgef17	APN	7	100929449	missense	probably benign
IGL01071:Arhgef17	APN	7	100885700	missense	probably damaging	0.99
IGL01882:Arhgef17	APN	7	100878580	nonsense	probably null
IGL01995:Arhgef17	APN	7	100928655	missense	probably benign	0.02
IGL02213:Arhgef17	APN	7	100890426	missense	probably benign
IGL02380:Arhgef17	APN	7	100929443	missense	possibly damaging	0.60
IGL02551:Arhgef17	APN	7	100930346	missense	probably damaging	1.00
IGL02613:Arhgef17	APN	7	100928896	missense	probably damaging	1.00
IGL02643:Arhgef17	APN	7	100883882	missense	possibly damaging	0.95
IGL02798:Arhgef17	APN	7	100929626	missense	probably benign	0.00
IGL03113:Arhgef17	APN	7	100929731	missense	probably benign	0.00
IGL03264:Arhgef17	APN	7	100880013	missense	probably benign	0.00
G1Funyon:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R0064:Arhgef17	UTSW	7	100881354	missense	probably benign	0.00
R0189:Arhgef17	UTSW	7	100928850	missense	probably damaging	1.00
R0482:Arhgef17	UTSW	7	100880621	missense	probably damaging	1.00
R0826:Arhgef17	UTSW	7	100930743	missense	probably benign	0.01
R1295:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1296:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1389:Arhgef17	UTSW	7	100931037	small deletion	probably benign
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1513:Arhgef17	UTSW	7	100930862	missense	probably benign
R1539:Arhgef17	UTSW	7	100890473	missense	probably damaging	1.00
R1644:Arhgef17	UTSW	7	100929504	missense	probably damaging	1.00
R1789:Arhgef17	UTSW	7	100929870	missense	probably damaging	1.00
R1861:Arhgef17	UTSW	7	100882268	missense	probably damaging	1.00
R1868:Arhgef17	UTSW	7	100878977	missense	probably benign
R2009:Arhgef17	UTSW	7	100881781	missense	probably damaging	0.98
R2095:Arhgef17	UTSW	7	100881263	missense	probably damaging	1.00
R2311:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35
R3607:Arhgef17	UTSW	7	100931172	missense	probably damaging	1.00
R3882:Arhgef17	UTSW	7	100876454	missense	possibly damaging	0.70
R4089:Arhgef17	UTSW	7	100883799	missense	probably damaging	1.00
R4420:Arhgef17	UTSW	7	100882308	splice site	probably benign
R4536:Arhgef17	UTSW	7	100929854	missense	probably damaging	1.00
R4548:Arhgef17	UTSW	7	100931129	missense	possibly damaging	0.60
R4616:Arhgef17	UTSW	7	100882485	missense	probably damaging	1.00
R5040:Arhgef17	UTSW	7	100876825	missense	probably benign	0.17
R5100:Arhgef17	UTSW	7	100881756	missense	possibly damaging	0.90
R5233:Arhgef17	UTSW	7	100881369	missense	possibly damaging	0.61
R5307:Arhgef17	UTSW	7	100929428	missense	probably benign	0.00
R5313:Arhgef17	UTSW	7	100928924	missense	probably damaging	0.99
R5643:Arhgef17	UTSW	7	100880011	missense	probably damaging	1.00
R5704:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6166:Arhgef17	UTSW	7	100876492	missense	probably damaging	1.00
R6417:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6420:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6510:Arhgef17	UTSW	7	100878536	missense	probably damaging	0.97
R6877:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6888:Arhgef17	UTSW	7	100930820	missense	possibly damaging	0.74
R7016:Arhgef17	UTSW	7	100878977	missense	probably benign
R7073:Arhgef17	UTSW	7	100929991	nonsense	probably null
R7322:Arhgef17	UTSW	7	100877797	missense	probably benign	0.01
R7691:Arhgef17	UTSW	7	100929642	missense	probably damaging	1.00
R7724:Arhgef17	UTSW	7	100880609	missense	probably damaging	1.00
R7728:Arhgef17	UTSW	7	100930068	missense	probably benign	0.00
R7829:Arhgef17	UTSW	7	100876845	missense	probably benign	0.03
R8072:Arhgef17	UTSW	7	100881797	missense	probably benign	0.04
R8301:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R8935:Arhgef17	UTSW	7	100878117	missense	probably benign	0.03
R8958:Arhgef17	UTSW	7	100929812	missense	probably damaging	0.98
R9221:Arhgef17	UTSW	7	100879611	missense	possibly damaging	0.78
R9362:Arhgef17	UTSW	7	100930958	missense	probably benign	0.12
R9499:Arhgef17	UTSW	7	100876895	missense	possibly damaging	0.52
R9593:Arhgef17	UTSW	7	100882802	missense	probably damaging	1.00
X0012:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CTGAAGGTGGCACTTTTCGTCTC -3'
(R):5'- AGAGGAAGACCCATTGCCAC -3'

Sequencing Primer
(F):5'- TCTCAGGAGACACAAGGGCC -3'
(R):5'- CACTCGTGGTCCAGGATCAGTATG -3'

Posted On

2020-01-23