Incidental Mutation 'R8036:Mlkl'
ID618250
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Namemixed lineage kinase domain-like
Synonyms9130019I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111311797-111338177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111333454 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 100 (V100E)
Ref Sequence ENSEMBL: ENSMUSP00000055521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432] [ENSMUST00000145862]
PDB Structure Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056157
AA Change: V100E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: V100E

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120432
AA Change: V100E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: V100E

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145862
AA Change: V108E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114701
Gene: ENSMUSG00000012519
AA Change: V108E

DomainStartEndE-ValueType
PDB:4BTF|A 9 176 1e-114 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
Ghoulish UTSW 8 111322748 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R7728:Mlkl UTSW 8 111333619 missense probably damaging 1.00
R8064:Mlkl UTSW 8 111312068 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACCAAAGTGAAGCTAGGATGCTC -3'
(R):5'- TACAGCCTCTCCAGAGACTC -3'

Sequencing Primer
(F):5'- AAGCTAGGATGCTCCCCGAG -3'
(R):5'- TCTCCAGAGACTCCAGGC -3'
Posted On2020-01-23