Incidental Mutation 'R8036:Spata20'
ID618257
Institutional Source Beutler Lab
Gene Symbol Spata20
Ensembl Gene ENSMUSG00000020867
Gene Namespermatogenesis associated 20
SynonymsTisp78
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94478904-94486179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94479137 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 778 (I778L)
Ref Sequence ENSEMBL: ENSMUSP00000042572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021234] [ENSMUST00000041705]
Predicted Effect probably benign
Transcript: ENSMUST00000021234
SMART Domains Protein: ENSMUSP00000021234
Gene: ENSMUSG00000020866

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 9.2e-66 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 7.9e-46 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 3e-55 PFAM
coiled coil region 1519 1559 N/A INTRINSIC
low complexity region 1562 1573 N/A INTRINSIC
Pfam:Ion_trans 1630 1835 3e-49 PFAM
Pfam:PKD_channel 1688 1842 7.8e-11 PFAM
low complexity region 2180 2211 N/A INTRINSIC
low complexity region 2230 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041705
AA Change: I778L

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042572
Gene: ENSMUSG00000020867
AA Change: I778L

DomainStartEndE-ValueType
Pfam:Thioredox_DsbH 66 228 2.9e-75 PFAM
Pfam:Thioredoxin_7 86 176 1.5e-13 PFAM
SCOP:d1fp3a_ 464 686 8e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kctd13 A G 7: 126,929,242 D63G possibly damaging Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Spata20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Spata20 APN 11 94479117 missense probably damaging 1.00
IGL01123:Spata20 APN 11 94483395 missense probably benign
IGL02008:Spata20 APN 11 94483463 missense probably damaging 1.00
PIT4458001:Spata20 UTSW 11 94484608 missense probably damaging 1.00
R0136:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R0243:Spata20 UTSW 11 94481646 missense probably benign
R0557:Spata20 UTSW 11 94485222 missense probably benign 0.00
R0657:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R1712:Spata20 UTSW 11 94480514 missense probably benign
R2166:Spata20 UTSW 11 94479104 missense probably benign 0.25
R4298:Spata20 UTSW 11 94483088 missense probably damaging 0.99
R4740:Spata20 UTSW 11 94484578 missense possibly damaging 0.94
R4791:Spata20 UTSW 11 94484586 missense probably damaging 0.99
R4980:Spata20 UTSW 11 94484609 missense probably damaging 1.00
R5894:Spata20 UTSW 11 94483618 missense probably damaging 0.98
R6373:Spata20 UTSW 11 94483400 missense probably benign
R7400:Spata20 UTSW 11 94483400 missense probably benign
R7439:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7441:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7562:Spata20 UTSW 11 94482553 missense probably benign 0.31
R7974:Spata20 UTSW 11 94484140 missense possibly damaging 0.66
R8060:Spata20 UTSW 11 94482239 missense probably benign
R8335:Spata20 UTSW 11 94482543 missense probably benign 0.05
R8447:Spata20 UTSW 11 94482254 missense probably damaging 1.00
R8676:Spata20 UTSW 11 94481781 missense probably damaging 1.00
Z1176:Spata20 UTSW 11 94480535 missense probably benign 0.45
Z1177:Spata20 UTSW 11 94483139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCACGGGACACTGTTAG -3'
(R):5'- TCTCCCAGGTGACACTTTGTG -3'

Sequencing Primer
(F):5'- CCACGGGACACTGTTAGGTTTATTTC -3'
(R):5'- CCAGGTGACACTTTGTGCTCTG -3'
Posted On2020-01-23