Incidental Mutation 'R0661:Hoxd12'
ID61826
Institutional Source Beutler Lab
Gene Symbol Hoxd12
Ensembl Gene ENSMUSG00000001823
Gene Namehomeobox D12
SynonymsHox-4.7, Hox-5.6
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R0661 (G1)
Quality Score117
Status Not validated
Chromosome2
Chromosomal Location74675013-74677705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74675892 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 216 (E216G)
Ref Sequence ENSEMBL: ENSMUSP00000001878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872] [ENSMUST00000001878]
Predicted Effect probably benign
Transcript: ENSMUST00000001872
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000001878
AA Change: E216G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823
AA Change: E216G

DomainStartEndE-ValueType
HOX 200 262 4.57e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048086
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit minor forelimb defects affecting carpals, metacarpals, and phalanges, and alterations of smooth muscle layers of the rectum resulting in malformation of the internal anal sphincter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Hoxd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Hoxd12 APN 2 74675427 missense probably damaging 1.00
IGL01324:Hoxd12 APN 2 74675136 missense probably damaging 1.00
IGL02229:Hoxd12 APN 2 74675934 missense probably damaging 1.00
IGL02684:Hoxd12 APN 2 74675561 missense probably benign
R0975:Hoxd12 UTSW 2 74675934 missense probably damaging 1.00
R1931:Hoxd12 UTSW 2 74675513 missense probably benign
R1931:Hoxd12 UTSW 2 74675531 missense probably benign 0.00
R2510:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R2511:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R3946:Hoxd12 UTSW 2 74675427 missense probably damaging 1.00
R5194:Hoxd12 UTSW 2 74675103 missense probably damaging 1.00
R7326:Hoxd12 UTSW 2 74675246 missense possibly damaging 0.48
R7426:Hoxd12 UTSW 2 74675225 missense possibly damaging 0.82
R7972:Hoxd12 UTSW 2 74675925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCTCCAGCTTCAAGGAAGAC -3'
(R):5'- TAATAGAGGGCCAGTGCTTGCTCG -3'

Sequencing Primer
(F):5'- CTCAACTTGAACATGGCAGTG -3'
(R):5'- TGCTCGCGCTGCACTAC -3'
Posted On2013-07-30