Incidental Mutation 'R0661:Asxl1'
ID 61828
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Name ASXL transcriptional regulator 1
Synonyms
MMRRC Submission 038846-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0661 (G1)
Quality Score 87
Status Not validated
Chromosome 2
Chromosomal Location 153187750-153245927 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 153242644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1065 (S1065T)
Ref Sequence ENSEMBL: ENSMUSP00000154224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
AlphaFold P59598
Predicted Effect probably benign
Transcript: ENSMUST00000109790
AA Change: S1066T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: S1066T

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138571
Predicted Effect possibly damaging
Transcript: ENSMUST00000227428
AA Change: S1065T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,370,163 (GRCm39) T148S possibly damaging Het
Anks3 A G 16: 4,766,198 (GRCm39) F124L probably damaging Het
Ar T A X: 97,194,171 (GRCm39) Y262N probably damaging Het
Brip1 A T 11: 86,001,189 (GRCm39) I749N possibly damaging Het
C1ra T A 6: 124,499,336 (GRCm39) H507Q probably benign Het
Cdk9 G A 2: 32,599,832 (GRCm39) T135I probably damaging Het
Col1a1 A G 11: 94,840,215 (GRCm39) T1088A unknown Het
Cpne2 T C 8: 95,282,667 (GRCm39) I283T possibly damaging Het
Dcaf17 T C 2: 70,918,779 (GRCm39) L451P probably damaging Het
Dhx57 C T 17: 80,576,293 (GRCm39) C599Y probably damaging Het
Drd1 T A 13: 54,207,057 (GRCm39) N379Y possibly damaging Het
Fsip2 A G 2: 82,816,513 (GRCm39) D4082G possibly damaging Het
Grin2a G T 16: 9,810,336 (GRCm39) P21Q probably damaging Het
Heyl G T 4: 123,139,824 (GRCm39) V128F probably damaging Het
Hoxd12 A G 2: 74,506,236 (GRCm39) E216G probably damaging Het
Inpp4b C A 8: 82,468,091 (GRCm39) A18E possibly damaging Het
Invs G A 4: 48,421,861 (GRCm39) R831H probably benign Het
Lrrk2 T C 15: 91,671,219 (GRCm39) V2000A probably damaging Het
Msh3 T C 13: 92,481,604 (GRCm39) N303D possibly damaging Het
Or11g27 A G 14: 50,771,552 (GRCm39) T228A probably benign Het
Or5an9 T C 19: 12,187,068 (GRCm39) L46P probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Pcdh18 A C 3: 49,707,767 (GRCm39) S902R possibly damaging Het
Prdm15 A T 16: 97,630,882 (GRCm39) V190E probably benign Het
Ranbp2 T G 10: 58,314,555 (GRCm39) S1758R probably benign Het
Rimbp2 A G 5: 128,863,774 (GRCm39) V738A probably benign Het
Rtl5 T C X: 101,114,056 (GRCm39) H138R possibly damaging Het
Sec11a A G 7: 80,584,787 (GRCm39) V50A probably damaging Het
Shroom1 T C 11: 53,357,764 (GRCm39) S772P possibly damaging Het
Slc26a6 T C 9: 108,736,312 (GRCm39) probably null Het
Slf1 A G 13: 77,231,715 (GRCm39) W555R probably benign Het
Spx A G 6: 142,359,565 (GRCm39) S5G possibly damaging Het
Tcp1 T C 17: 13,142,200 (GRCm39) V398A probably benign Het
Tm6sf1 G A 7: 81,515,093 (GRCm39) probably null Het
Tsbp1 A T 17: 34,678,887 (GRCm39) I217F possibly damaging Het
Ufsp2 T A 8: 46,432,270 (GRCm39) M1K probably null Het
Usf1 G A 1: 171,245,067 (GRCm39) R196Q probably damaging Het
Vmn2r75 G A 7: 85,814,866 (GRCm39) A209V probably benign Het
Yme1l1 T A 2: 23,081,054 (GRCm39) M442K probably damaging Het
Zfand3 A G 17: 30,354,372 (GRCm39) E63G probably damaging Het
Zfp740 A G 15: 102,121,094 (GRCm39) T136A possibly damaging Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153,234,860 (GRCm39) splice site probably benign
IGL01432:Asxl1 APN 2 153,242,125 (GRCm39) missense probably benign 0.38
IGL01543:Asxl1 APN 2 153,243,404 (GRCm39) missense probably benign 0.11
IGL02355:Asxl1 APN 2 153,243,706 (GRCm39) missense probably benign 0.34
IGL02362:Asxl1 APN 2 153,243,706 (GRCm39) missense probably benign 0.34
IGL02645:Asxl1 APN 2 153,234,777 (GRCm39) missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153,242,115 (GRCm39) nonsense probably null
IGL03365:Asxl1 APN 2 153,243,674 (GRCm39) missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153,242,333 (GRCm39) missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153,238,700 (GRCm39) missense probably damaging 1.00
astrophel UTSW 2 153,242,026 (GRCm39) missense possibly damaging 0.75
hairbrush UTSW 2 153,242,644 (GRCm39) missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153,242,129 (GRCm39) missense probably benign 0.06
R0044:Asxl1 UTSW 2 153,242,129 (GRCm39) missense probably benign 0.06
R0600:Asxl1 UTSW 2 153,241,824 (GRCm39) missense probably benign 0.00
R0659:Asxl1 UTSW 2 153,242,644 (GRCm39) missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153,239,442 (GRCm39) missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153,242,375 (GRCm39) missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153,235,374 (GRCm39) missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153,243,526 (GRCm39) missense probably benign 0.31
R1914:Asxl1 UTSW 2 153,243,826 (GRCm39) missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153,194,187 (GRCm39) missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153,243,820 (GRCm39) missense probably benign 0.13
R2910:Asxl1 UTSW 2 153,242,959 (GRCm39) missense probably benign 0.00
R3620:Asxl1 UTSW 2 153,199,075 (GRCm39) missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153,241,264 (GRCm39) missense probably benign 0.04
R4200:Asxl1 UTSW 2 153,242,026 (GRCm39) missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153,243,905 (GRCm39) missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153,241,751 (GRCm39) missense probably benign 0.02
R5100:Asxl1 UTSW 2 153,239,851 (GRCm39) missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153,242,875 (GRCm39) missense probably benign 0.00
R5166:Asxl1 UTSW 2 153,243,041 (GRCm39) missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153,241,504 (GRCm39) missense probably benign 0.04
R5701:Asxl1 UTSW 2 153,241,409 (GRCm39) missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153,241,310 (GRCm39) missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153,243,931 (GRCm39) missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153,233,744 (GRCm39) critical splice donor site probably null
R7023:Asxl1 UTSW 2 153,242,469 (GRCm39) missense probably benign 0.00
R7028:Asxl1 UTSW 2 153,242,027 (GRCm39) missense probably benign 0.00
R7176:Asxl1 UTSW 2 153,243,908 (GRCm39) missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153,239,355 (GRCm39) missense probably benign 0.01
R7378:Asxl1 UTSW 2 153,243,913 (GRCm39) missense probably damaging 1.00
R7464:Asxl1 UTSW 2 153,239,705 (GRCm39) missense probably benign 0.01
R7678:Asxl1 UTSW 2 153,242,572 (GRCm39) missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153,233,534 (GRCm39) missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153,241,943 (GRCm39) missense probably benign 0.00
R7838:Asxl1 UTSW 2 153,238,733 (GRCm39) missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153,241,854 (GRCm39) missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153,241,321 (GRCm39) missense probably damaging 1.00
R8354:Asxl1 UTSW 2 153,235,345 (GRCm39) missense probably benign 0.40
R8383:Asxl1 UTSW 2 153,235,639 (GRCm39) missense probably damaging 1.00
R8995:Asxl1 UTSW 2 153,235,886 (GRCm39) missense probably damaging 1.00
R9183:Asxl1 UTSW 2 153,239,840 (GRCm39) missense probably damaging 0.99
X0024:Asxl1 UTSW 2 153,243,905 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCTCACTGTCCAAGGTGAAC -3'
(R):5'- TGACAAGACCAGCACTTGCTCC -3'

Sequencing Primer
(F):5'- CTGTCCAAGGTGAACAATGAC -3'
(R):5'- TGGGCCAGAATAGACTCTTTC -3'
Posted On 2013-07-30