Incidental Mutation 'R8037:Adgrf3'
ID 618281
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms Gpr113, LOC381628, PGR23
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8037 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30193431-30205722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30199512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 309 (C309S)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably damaging
Transcript: ENSMUST00000088117
AA Change: C309S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: C309S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,293,904 W1922C probably damaging Het
Acad11 T A 9: 104,075,836 I88N possibly damaging Het
Ankhd1 T A 18: 36,638,623 V1343E probably damaging Het
Aqr A T 2: 114,161,680 Y72N probably damaging Het
Bptf T C 11: 107,055,950 T2339A probably damaging Het
Ccr8 T C 9: 120,094,370 F184L probably benign Het
Dbh A G 2: 27,165,688 D58G probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dhdds G A 4: 133,996,847 T52I probably benign Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Efemp2 C T 19: 5,480,113 Q290* probably null Het
Eipr1 A G 12: 28,864,677 S277G probably benign Het
Fam110b A G 4: 5,799,511 I310V possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Fsip2 T A 2: 82,985,978 N4018K possibly damaging Het
Gm12887 T A 4: 121,615,690 D85V probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6583 A G 5: 112,355,016 V274A probably benign Het
Gys2 A G 6: 142,448,393 V473A probably benign Het
Hnrnpu A T 1: 178,332,352 F388Y unknown Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ier5 A T 1: 155,099,429 M1K probably null Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Lrch1 T C 14: 74,786,354 D577G probably damaging Het
Lrrk1 A T 7: 66,285,341 M1010K probably benign Het
Mttp T G 3: 138,091,122 N873T probably damaging Het
Nphs2 A G 1: 156,310,830 R15G possibly damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1242 A T 2: 89,493,711 N200K possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pcdhga8 T C 18: 37,727,018 S376P probably damaging Het
Pde3a A G 6: 141,483,924 N737S possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Rin1 T A 19: 5,051,824 L179Q probably damaging Het
Sec63 T A 10: 42,783,487 M57K probably benign Het
Senp2 C T 16: 22,014,138 Q59* probably null Het
St8sia5 G A 18: 77,248,542 V224I possibly damaging Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tead1 A G 7: 112,759,520 D13G possibly damaging Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem8 T C 17: 26,117,535 L209P possibly damaging Het
Tnni2 A G 7: 142,443,954 R109G probably damaging Het
Unc79 A G 12: 103,049,919 K320R probably damaging Het
Vmn1r9 T A 6: 57,071,003 V21D probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8281:Adgrf3 UTSW 5 30197303 missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30198581 unclassified probably benign
R8857:Adgrf3 UTSW 5 30197067 nonsense probably null
R8926:Adgrf3 UTSW 5 30200448 missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30195073 missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30196959 missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30199484 missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTTTCAGAGACAAGCCACTCAG -3'
(R):5'- GCCCAGAGCTAGAGACATTC -3'

Sequencing Primer
(F):5'- AGCCACTCAGAGGTCAGC -3'
(R):5'- GACATTCCAATAGGATGCACTTCAG -3'
Posted On 2020-01-23