Incidental Mutation 'R8037:Adgrf3'
ID 618281
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms PGR23, LOC381628, Gpr113
MMRRC Submission 067474-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8037 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30398429-30410720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30404510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 309 (C309S)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably damaging
Transcript: ENSMUST00000088117
AA Change: C309S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: C309S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,243,904 (GRCm39) W1922C probably damaging Het
Acad11 T A 9: 103,953,035 (GRCm39) I88N possibly damaging Het
Ankhd1 T A 18: 36,771,676 (GRCm39) V1343E probably damaging Het
Aqr A T 2: 113,992,161 (GRCm39) Y72N probably damaging Het
Bptf T C 11: 106,946,776 (GRCm39) T2339A probably damaging Het
Ccdc121rt3 A G 5: 112,502,882 (GRCm39) V274A probably benign Het
Ccr8 T C 9: 119,923,436 (GRCm39) F184L probably benign Het
Dbh A G 2: 27,055,700 (GRCm39) D58G probably damaging Het
Depdc5 T C 5: 33,116,692 (GRCm39) probably null Het
Dhdds G A 4: 133,724,158 (GRCm39) T52I probably benign Het
Dnmt1 A C 9: 20,852,860 (GRCm39) V82G probably damaging Het
Efemp2 C T 19: 5,530,141 (GRCm39) Q290* probably null Het
Eipr1 A G 12: 28,914,676 (GRCm39) S277G probably benign Het
Fam110b A G 4: 5,799,511 (GRCm39) I310V possibly damaging Het
Foxn4 T C 5: 114,394,658 (GRCm39) D423G probably damaging Het
Fsip2 T A 2: 82,816,322 (GRCm39) N4018K possibly damaging Het
Gm12887 T A 4: 121,472,887 (GRCm39) D85V probably damaging Het
Gys2 A G 6: 142,394,119 (GRCm39) V473A probably benign Het
Hnrnpu A T 1: 178,159,917 (GRCm39) F388Y unknown Het
Hoxa5 A G 6: 52,181,309 (GRCm39) S8P probably damaging Het
Ier5 A T 1: 154,975,175 (GRCm39) M1K probably null Het
Ighv1-52 A G 12: 115,109,210 (GRCm39) F83S probably damaging Het
Lrch1 T C 14: 75,023,794 (GRCm39) D577G probably damaging Het
Lrrk1 A T 7: 65,935,089 (GRCm39) M1010K probably benign Het
Mttp T G 3: 137,796,883 (GRCm39) N873T probably damaging Het
Nphs2 A G 1: 156,138,400 (GRCm39) R15G possibly damaging Het
Or4a70 A T 2: 89,324,055 (GRCm39) N200K possibly damaging Het
Or5d16 T C 2: 87,773,319 (GRCm39) T218A probably benign Het
Or8d6 T A 9: 39,854,177 (GRCm39) V207D probably damaging Het
Pcdhga8 T C 18: 37,860,071 (GRCm39) S376P probably damaging Het
Pde3a A G 6: 141,429,650 (GRCm39) N737S possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgap6 T C 17: 26,336,509 (GRCm39) L209P possibly damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Rin1 T A 19: 5,101,852 (GRCm39) L179Q probably damaging Het
Sec63 T A 10: 42,659,483 (GRCm39) M57K probably benign Het
Senp2 C T 16: 21,832,888 (GRCm39) Q59* probably null Het
St8sia5 G A 18: 77,336,238 (GRCm39) V224I possibly damaging Het
Sycp2 A T 2: 178,045,571 (GRCm39) D16E probably damaging Het
Tab1 A G 15: 80,044,471 (GRCm39) T500A probably benign Het
Tead1 A G 7: 112,358,727 (GRCm39) D13G possibly damaging Het
Tecpr2 T C 12: 110,902,854 (GRCm39) F860L probably benign Het
Tg A G 15: 66,560,724 (GRCm39) M1029V probably benign Het
Tnni2 A G 7: 141,997,691 (GRCm39) R109G probably damaging Het
Unc79 A G 12: 103,016,178 (GRCm39) K320R probably damaging Het
Vmn1r9 T A 6: 57,047,988 (GRCm39) V21D probably benign Het
Zfp64 A G 2: 168,741,932 (GRCm39) F332S probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30,401,827 (GRCm39) missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30,401,292 (GRCm39) missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30,410,607 (GRCm39) splice site probably benign
R0042:Adgrf3 UTSW 5 30,402,426 (GRCm39) missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30,401,379 (GRCm39) missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30,400,078 (GRCm39) missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30,401,874 (GRCm39) missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30,404,532 (GRCm39) missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30,400,093 (GRCm39) missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30,407,227 (GRCm39) splice site probably benign
R1695:Adgrf3 UTSW 5 30,408,553 (GRCm39) missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30,402,549 (GRCm39) missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30,404,211 (GRCm39) missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30,404,489 (GRCm39) missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30,401,436 (GRCm39) missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30,402,358 (GRCm39) missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30,405,432 (GRCm39) unclassified probably benign
R4043:Adgrf3 UTSW 5 30,409,360 (GRCm39) missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30,402,367 (GRCm39) nonsense probably null
R4575:Adgrf3 UTSW 5 30,407,255 (GRCm39) missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30,402,615 (GRCm39) critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30,403,442 (GRCm39) missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30,405,476 (GRCm39) missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30,404,146 (GRCm39) missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30,402,304 (GRCm39) missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30,410,637 (GRCm39) missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30,403,360 (GRCm39) critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30,401,265 (GRCm39) missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30,402,531 (GRCm39) missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30,402,312 (GRCm39) missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30,401,522 (GRCm39) missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30,408,601 (GRCm39) missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30,401,385 (GRCm39) missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30,402,519 (GRCm39) missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30,409,378 (GRCm39) nonsense probably null
R7250:Adgrf3 UTSW 5 30,400,680 (GRCm39) missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30,403,495 (GRCm39) missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30,407,245 (GRCm39) missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30,402,204 (GRCm39) missense probably benign 0.41
R8281:Adgrf3 UTSW 5 30,402,301 (GRCm39) missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30,403,579 (GRCm39) unclassified probably benign
R8857:Adgrf3 UTSW 5 30,402,065 (GRCm39) nonsense probably null
R8926:Adgrf3 UTSW 5 30,405,446 (GRCm39) missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30,400,071 (GRCm39) missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30,401,957 (GRCm39) missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30,404,482 (GRCm39) missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30,404,118 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTTTCAGAGACAAGCCACTCAG -3'
(R):5'- GCCCAGAGCTAGAGACATTC -3'

Sequencing Primer
(F):5'- AGCCACTCAGAGGTCAGC -3'
(R):5'- GACATTCCAATAGGATGCACTTCAG -3'
Posted On 2020-01-23