Incidental Mutation 'R8037:Sec63'
ID618298
Institutional Source Beutler Lab
Gene Symbol Sec63
Ensembl Gene ENSMUSG00000019802
Gene NameSEC63-like (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8037 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location42761496-42832514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42783487 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 57 (M57K)
Ref Sequence ENSEMBL: ENSMUSP00000019937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019937]
Predicted Effect probably benign
Transcript: ENSMUST00000019937
AA Change: M57K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802
AA Change: M57K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
DnaJ 103 157 6.14e-23 SMART
Blast:Sec63 170 208 9e-6 BLAST
Sec63 219 714 6.98e-10 SMART
low complexity region 734 760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,293,904 W1922C probably damaging Het
Acad11 T A 9: 104,075,836 I88N possibly damaging Het
Adgrf3 A T 5: 30,199,512 C309S probably damaging Het
Ankhd1 T A 18: 36,638,623 V1343E probably damaging Het
Aqr A T 2: 114,161,680 Y72N probably damaging Het
Bptf T C 11: 107,055,950 T2339A probably damaging Het
Ccr8 T C 9: 120,094,370 F184L probably benign Het
Dbh A G 2: 27,165,688 D58G probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dhdds G A 4: 133,996,847 T52I probably benign Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Efemp2 C T 19: 5,480,113 Q290* probably null Het
Eipr1 A G 12: 28,864,677 S277G probably benign Het
Fam110b A G 4: 5,799,511 I310V possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Fsip2 T A 2: 82,985,978 N4018K possibly damaging Het
Gm12887 T A 4: 121,615,690 D85V probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6583 A G 5: 112,355,016 V274A probably benign Het
Gys2 A G 6: 142,448,393 V473A probably benign Het
Hnrnpu A T 1: 178,332,352 F388Y unknown Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ier5 A T 1: 155,099,429 M1K probably null Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Lrch1 T C 14: 74,786,354 D577G probably damaging Het
Lrrk1 A T 7: 66,285,341 M1010K probably benign Het
Mttp T G 3: 138,091,122 N873T probably damaging Het
Nphs2 A G 1: 156,310,830 R15G possibly damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1242 A T 2: 89,493,711 N200K possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pcdhga8 T C 18: 37,727,018 S376P probably damaging Het
Pde3a A G 6: 141,483,924 N737S possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Rin1 T A 19: 5,051,824 L179Q probably damaging Het
Senp2 C T 16: 22,014,138 Q59* probably null Het
St8sia5 G A 18: 77,248,542 V224I possibly damaging Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tead1 A G 7: 112,759,520 D13G possibly damaging Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem8 T C 17: 26,117,535 L209P possibly damaging Het
Tnni2 A G 7: 142,443,954 R109G probably damaging Het
Unc79 A G 12: 103,049,919 K320R probably damaging Het
Vmn1r9 T A 6: 57,071,003 V21D probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Other mutations in Sec63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Sec63 APN 10 42812457 missense possibly damaging 0.56
IGL02111:Sec63 APN 10 42810888 missense probably damaging 1.00
IGL02457:Sec63 APN 10 42801733 splice site probably benign
IGL02613:Sec63 APN 10 42801707 missense probably damaging 1.00
IGL03002:Sec63 APN 10 42810909 missense possibly damaging 0.51
IGL03493:Sec63 APN 10 42828941 missense probably benign 0.06
cyst UTSW 10 42828865 splice site probably null
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0538:Sec63 UTSW 10 42798799 missense probably benign 0.01
R0734:Sec63 UTSW 10 42796208 missense probably benign 0.08
R0906:Sec63 UTSW 10 42801928 missense probably damaging 0.98
R1136:Sec63 UTSW 10 42806546 missense probably damaging 1.00
R1665:Sec63 UTSW 10 42798728 splice site probably null
R1736:Sec63 UTSW 10 42827918 nonsense probably null
R1961:Sec63 UTSW 10 42823886 missense probably damaging 1.00
R2696:Sec63 UTSW 10 42783526 missense probably benign 0.05
R4886:Sec63 UTSW 10 42789393 nonsense probably null
R4908:Sec63 UTSW 10 42805190 missense probably damaging 0.99
R5174:Sec63 UTSW 10 42829081 utr 3 prime probably benign
R5619:Sec63 UTSW 10 42789382 missense probably damaging 1.00
R5766:Sec63 UTSW 10 42801681 missense probably damaging 0.99
R5820:Sec63 UTSW 10 42796245 missense possibly damaging 0.49
R6232:Sec63 UTSW 10 42828865 splice site probably null
R6656:Sec63 UTSW 10 42816383 nonsense probably null
R6847:Sec63 UTSW 10 42791253 missense probably damaging 1.00
R6971:Sec63 UTSW 10 42783442 missense probably damaging 1.00
RF010:Sec63 UTSW 10 42806624 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGTGAAATGCTCAGACAACTG -3'
(R):5'- GCTCTCAAGCTTACTATTCAAACC -3'

Sequencing Primer
(F):5'- AAGTTTCAGAGAAGTTTCACGTG -3'
(R):5'- TATTCAAACCTCACCTCTCTCACAGG -3'
Posted On2020-01-23