Incidental Mutation 'R0661:Agtr1b'
List [record 1 of 42] next >> last >|
ID61830
Institutional Source Beutler Lab
Gene Symbol Agtr1b
Ensembl Gene ENSMUSG00000054988
Gene Nameangiotensin II receptor, type 1b
SynonymsAgtr-1b, Angtr-1b, AT1B
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0661 (G1)
Quality Score115
Status Not validated
Chromosome3
Chromosomal Location20314473-20367177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20315999 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 148 (T148S)
Ref Sequence ENSEMBL: ENSMUSP00000128724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068316] [ENSMUST00000163776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068316
AA Change: T148S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068298
Gene: ENSMUSG00000054988
AA Change: T148S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 3e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163776
AA Change: T148S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128724
Gene: ENSMUSG00000054988
AA Change: T148S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 1.1e-65 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal, but homozygotes for the Agtr1b/Agtr1a double knockout exhibit reductions in growth, survival, blood pressure, and kidney size not found in either single knockout. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Agtr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Agtr1b APN 3 20316260 missense probably damaging 0.99
IGL02706:Agtr1b APN 3 20315863 missense probably benign 0.01
IGL02958:Agtr1b APN 3 20316094 missense possibly damaging 0.91
IGL03243:Agtr1b APN 3 20315795 missense probably benign 0.13
R0125:Agtr1b UTSW 3 20315540 missense probably benign 0.00
R0565:Agtr1b UTSW 3 20315674 missense probably damaging 0.99
R1070:Agtr1b UTSW 3 20315748 missense probably benign 0.34
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1713:Agtr1b UTSW 3 20316309 missense probably benign 0.00
R4502:Agtr1b UTSW 3 20315798 missense probably damaging 1.00
R5613:Agtr1b UTSW 3 20316260 missense probably damaging 0.99
R6142:Agtr1b UTSW 3 20316394 missense probably benign 0.06
R6320:Agtr1b UTSW 3 20315779 missense probably benign 0.22
R6667:Agtr1b UTSW 3 20315749 missense possibly damaging 0.91
R6987:Agtr1b UTSW 3 20316421 missense probably benign 0.00
R7407:Agtr1b UTSW 3 20315731 missense possibly damaging 0.79
R7598:Agtr1b UTSW 3 20315913 missense possibly damaging 0.91
X0037:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0060:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20315506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACAGTCATGGATGACGCCCAG -3'
(R):5'- ACCTATGTAAGATCGCTTCGGCCAG -3'

Sequencing Primer
(F):5'- GGGCTTTCCAAATCAGAGTATAGC -3'
(R):5'- GCCAGCGTCAGTTTCAAC -3'
Posted On2013-07-30