Mutagenetix > Incidental Mutation

Incidental Mutation 'R8037:Bptf'

618300

Institutional Source

Beutler Lab

Gene Symbol

Bptf

Ensembl Gene

ENSMUSG00000040481

Gene Name

bromodomain PHD finger transcription factor

Synonyms

9430093H17Rik, Falz

MMRRC Submission

067474-MU

Accession Numbers

Genbank: NM_176850; MGI: 2444008

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8037 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107033081-107132127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107055950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2339 (T2339A)

Ref Sequence

ENSEMBL: ENSMUSP00000102374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000133317] [ENSMUST00000149486]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057892
AA Change: T2224A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T2224A

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
coiled coil region	864	894	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1062	1072	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1491	1503	N/A	INTRINSIC
low complexity region	1594	1613	N/A	INTRINSIC
low complexity region	1636	1645	N/A	INTRINSIC
low complexity region	1665	1683	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
coiled coil region	1908	1936	N/A	INTRINSIC
low complexity region	1941	1957	N/A	INTRINSIC
low complexity region	2051	2061	N/A	INTRINSIC
low complexity region	2092	2107	N/A	INTRINSIC
low complexity region	2115	2128	N/A	INTRINSIC
low complexity region	2175	2197	N/A	INTRINSIC
low complexity region	2227	2252	N/A	INTRINSIC
low complexity region	2275	2312	N/A	INTRINSIC
low complexity region	2336	2355	N/A	INTRINSIC
low complexity region	2361	2378	N/A	INTRINSIC
low complexity region	2390	2420	N/A	INTRINSIC
low complexity region	2430	2463	N/A	INTRINSIC
coiled coil region	2489	2527	N/A	INTRINSIC
coiled coil region	2576	2604	N/A	INTRINSIC
low complexity region	2663	2700	N/A	INTRINSIC
low complexity region	2713	2736	N/A	INTRINSIC
PHD	2744	2791	5.32e-9	SMART
BROMO	2800	2908	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106762
AA Change: T2276A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T2276A

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
internal_repeat_1	589	642	6.48e-5	PROSPERO
low complexity region	644	654	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC
coiled coil region	926	956	N/A	INTRINSIC
low complexity region	1013	1025	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1114	1124	N/A	INTRINSIC
low complexity region	1138	1150	N/A	INTRINSIC
low complexity region	1277	1290	N/A	INTRINSIC
low complexity region	1303	1317	N/A	INTRINSIC
internal_repeat_1	1387	1440	6.48e-5	PROSPERO
low complexity region	1543	1555	N/A	INTRINSIC
low complexity region	1646	1665	N/A	INTRINSIC
low complexity region	1688	1697	N/A	INTRINSIC
low complexity region	1717	1735	N/A	INTRINSIC
low complexity region	1870	1886	N/A	INTRINSIC
coiled coil region	1960	1988	N/A	INTRINSIC
low complexity region	1993	2009	N/A	INTRINSIC
low complexity region	2103	2113	N/A	INTRINSIC
low complexity region	2144	2159	N/A	INTRINSIC
low complexity region	2167	2180	N/A	INTRINSIC
low complexity region	2227	2249	N/A	INTRINSIC
low complexity region	2279	2304	N/A	INTRINSIC
low complexity region	2327	2364	N/A	INTRINSIC
low complexity region	2388	2407	N/A	INTRINSIC
low complexity region	2413	2430	N/A	INTRINSIC
low complexity region	2442	2472	N/A	INTRINSIC
low complexity region	2482	2515	N/A	INTRINSIC
coiled coil region	2541	2579	N/A	INTRINSIC
coiled coil region	2628	2656	N/A	INTRINSIC
low complexity region	2715	2752	N/A	INTRINSIC
low complexity region	2765	2788	N/A	INTRINSIC
PHD	2796	2843	5.32e-9	SMART
BROMO	2852	2960	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106763
AA Change: T2339A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T2339A

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.9e-8	PFAM
PHD	404	447	2.23e-11	SMART
low complexity region	624	639	N/A	INTRINSIC
low complexity region	707	717	N/A	INTRINSIC
low complexity region	725	742	N/A	INTRINSIC
coiled coil region	989	1019	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
low complexity region	1201	1213	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1366	1380	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1709	1728	N/A	INTRINSIC
low complexity region	1751	1760	N/A	INTRINSIC
low complexity region	1780	1798	N/A	INTRINSIC
low complexity region	1933	1949	N/A	INTRINSIC
coiled coil region	2023	2051	N/A	INTRINSIC
low complexity region	2056	2072	N/A	INTRINSIC
low complexity region	2166	2176	N/A	INTRINSIC
low complexity region	2207	2222	N/A	INTRINSIC
low complexity region	2230	2243	N/A	INTRINSIC
low complexity region	2290	2312	N/A	INTRINSIC
low complexity region	2342	2367	N/A	INTRINSIC
low complexity region	2390	2427	N/A	INTRINSIC
low complexity region	2451	2470	N/A	INTRINSIC
low complexity region	2476	2493	N/A	INTRINSIC
low complexity region	2505	2535	N/A	INTRINSIC
low complexity region	2545	2578	N/A	INTRINSIC
coiled coil region	2604	2642	N/A	INTRINSIC
coiled coil region	2691	2719	N/A	INTRINSIC
low complexity region	2778	2815	N/A	INTRINSIC
low complexity region	2828	2851	N/A	INTRINSIC
PHD	2859	2906	5.32e-9	SMART
BROMO	2915	3023	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133317

SMART Domains

Protein: ENSMUSP00000118875
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
low complexity region	57	94	N/A	INTRINSIC
low complexity region	107	130	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000149486

SMART Domains

Protein: ENSMUSP00000122575
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
coiled coil region	70	98	N/A	INTRINSIC
low complexity region	103	119	N/A	INTRINSIC
low complexity region	171	188	N/A	INTRINSIC
low complexity region	267	277	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]

Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	T	11: 9,293,904	W1922C	probably damaging	Het
Acad11	T	A	9: 104,075,836	I88N	possibly damaging	Het
Adgrf3	A	T	5: 30,199,512	C309S	probably damaging	Het
Ankhd1	T	A	18: 36,638,623	V1343E	probably damaging	Het
Aqr	A	T	2: 114,161,680	Y72N	probably damaging	Het
Ccr8	T	C	9: 120,094,370	F184L	probably benign	Het
Dbh	A	G	2: 27,165,688	D58G	probably damaging	Het
Depdc5	T	C	5: 32,959,348		probably null	Het
Dhdds	G	A	4: 133,996,847	T52I	probably benign	Het
Dnmt1	A	C	9: 20,941,564	V82G	probably damaging	Het
Efemp2	C	T	19: 5,480,113	Q290*	probably null	Het
Eipr1	A	G	12: 28,864,677	S277G	probably benign	Het
Fam110b	A	G	4: 5,799,511	I310V	possibly damaging	Het
Foxn4	T	C	5: 114,256,597	D423G	probably damaging	Het
Fsip2	T	A	2: 82,985,978	N4018K	possibly damaging	Het
Gm12887	T	A	4: 121,615,690	D85V	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm6583	A	G	5: 112,355,016	V274A	probably benign	Het
Gys2	A	G	6: 142,448,393	V473A	probably benign	Het
Hnrnpu	A	T	1: 178,332,352	F388Y	unknown	Het
Hoxa5	A	G	6: 52,204,329	S8P	probably damaging	Het
Ier5	A	T	1: 155,099,429	M1K	probably null	Het
Ighv1-52	A	G	12: 115,145,590	F83S	probably damaging	Het
Lrch1	T	C	14: 74,786,354	D577G	probably damaging	Het
Lrrk1	A	T	7: 66,285,341	M1010K	probably benign	Het
Mttp	T	G	3: 138,091,122	N873T	probably damaging	Het
Nphs2	A	G	1: 156,310,830	R15G	possibly damaging	Het
Olfr1155	T	C	2: 87,942,975	T218A	probably benign	Het
Olfr1242	A	T	2: 89,493,711	N200K	possibly damaging	Het
Olfr974	T	A	9: 39,942,881	V207D	probably damaging	Het
Pcdhga8	T	C	18: 37,727,018	S376P	probably damaging	Het
Pde3a	A	G	6: 141,483,924	N737S	possibly damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Rin1	T	A	19: 5,051,824	L179Q	probably damaging	Het
Sec63	T	A	10: 42,783,487	M57K	probably benign	Het
Senp2	C	T	16: 22,014,138	Q59*	probably null	Het
St8sia5	G	A	18: 77,248,542	V224I	possibly damaging	Het
Sycp2	A	T	2: 178,403,778	D16E	probably damaging	Het
Tab1	A	G	15: 80,160,270	T500A	probably benign	Het
Tead1	A	G	7: 112,759,520	D13G	possibly damaging	Het
Tecpr2	T	C	12: 110,936,420	F860L	probably benign	Het
Tg	A	G	15: 66,688,875	M1029V	probably benign	Het
Tmem8	T	C	17: 26,117,535	L209P	possibly damaging	Het
Tnni2	A	G	7: 142,443,954	R109G	probably damaging	Het
Unc79	A	G	12: 103,049,919	K320R	probably damaging	Het
Vmn1r9	T	A	6: 57,071,003	V21D	probably benign	Het
Zfp64	A	G	2: 168,900,012	F332S	probably damaging	Het

Other mutations in Bptf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Bptf	APN	11	107055279	missense	possibly damaging	0.88
IGL00664:Bptf	APN	11	107077665	missense	possibly damaging	0.78
IGL00705:Bptf	APN	11	107095708	splice site	probably benign
IGL00796:Bptf	APN	11	107054550	missense	probably damaging	1.00
IGL00834:Bptf	APN	11	107073928	missense	possibly damaging	0.59
IGL01155:Bptf	APN	11	107080727	missense	probably damaging	1.00
IGL01314:Bptf	APN	11	107054853	missense	probably damaging	1.00
IGL01371:Bptf	APN	11	107055907	missense	probably benign	0.00
IGL01567:Bptf	APN	11	107058774	missense	probably damaging	1.00
IGL01794:Bptf	APN	11	107053221	critical splice donor site	probably null
IGL02108:Bptf	APN	11	107074988	missense	probably benign	0.45
IGL02367:Bptf	APN	11	107073352	missense	probably benign
IGL02437:Bptf	APN	11	107074695	missense	probably benign	0.00
IGL02589:Bptf	APN	11	107111531	missense	possibly damaging	0.92
IGL02897:Bptf	APN	11	107047121	missense	probably damaging	1.00
IGL02935:Bptf	APN	11	107080799	missense	probably damaging	1.00
IGL02954:Bptf	APN	11	107054749	missense	possibly damaging	0.89
IGL02982:Bptf	APN	11	107076674	missense	probably damaging	1.00
IGL03109:Bptf	APN	11	107061701	missense	possibly damaging	0.53
IGL03265:Bptf	APN	11	107054628	missense	probably benign	0.00
IGL03403:Bptf	APN	11	107099733	missense	possibly damaging	0.51
Anodyne	UTSW	11	107043631	critical splice donor site	probably null
Arroyo	UTSW	11	107042690	missense	probably benign	0.32
mojado	UTSW	11	107044640	missense	probably benign	0.03
IGL03097:Bptf	UTSW	11	107077680	missense	probably damaging	1.00
PIT4486001:Bptf	UTSW	11	107054788	missense	probably damaging	0.98
R0066:Bptf	UTSW	11	107062136	missense	possibly damaging	0.90
R0157:Bptf	UTSW	11	107074658	missense	possibly damaging	0.89
R0320:Bptf	UTSW	11	107072819	missense	probably damaging	1.00
R0328:Bptf	UTSW	11	107047127	missense	probably damaging	1.00
R0402:Bptf	UTSW	11	107074114	missense	probably damaging	1.00
R0482:Bptf	UTSW	11	107081262	missense	probably benign	0.13
R0574:Bptf	UTSW	11	107076527	missense	probably damaging	1.00
R0598:Bptf	UTSW	11	107072965	missense	probably damaging	0.99
R0599:Bptf	UTSW	11	107068382	missense	probably damaging	1.00
R0601:Bptf	UTSW	11	107061692	missense	probably benign	0.04
R0744:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0836:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0885:Bptf	UTSW	11	107043791	missense	probably damaging	1.00
R1070:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1252:Bptf	UTSW	11	107073251	missense	probably benign	0.00
R1370:Bptf	UTSW	11	107047094	missense	probably damaging	0.99
R1428:Bptf	UTSW	11	107073047	missense	probably damaging	0.99
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1742:Bptf	UTSW	11	107110951	missense	probably damaging	1.00
R1816:Bptf	UTSW	11	107060579	missense	probably damaging	1.00
R1858:Bptf	UTSW	11	107073301	missense	probably benign	0.00
R1989:Bptf	UTSW	11	107074826	missense	probably damaging	1.00
R2253:Bptf	UTSW	11	107111322	missense	probably damaging	1.00
R2392:Bptf	UTSW	11	107072747	missense	probably damaging	1.00
R2431:Bptf	UTSW	11	107047240	missense	possibly damaging	0.48
R3022:Bptf	UTSW	11	107111637	critical splice acceptor site	probably null
R3161:Bptf	UTSW	11	107074476	missense	probably damaging	1.00
R3686:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3687:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3688:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3787:Bptf	UTSW	11	107073827	missense	probably damaging	1.00
R3834:Bptf	UTSW	11	107073857	missense	probably benign	0.05
R3885:Bptf	UTSW	11	107074513	missense	probably damaging	0.97
R4090:Bptf	UTSW	11	107081523	missense	probably damaging	0.99
R4398:Bptf	UTSW	11	107110844	missense	probably damaging	1.00
R4437:Bptf	UTSW	11	107074474	missense	possibly damaging	0.59
R4514:Bptf	UTSW	11	107077692	missense	probably damaging	1.00
R4565:Bptf	UTSW	11	107073010	missense	probably damaging	1.00
R4715:Bptf	UTSW	11	107047181	missense	probably damaging	1.00
R4748:Bptf	UTSW	11	107095880	missense	probably damaging	0.96
R4764:Bptf	UTSW	11	107043694	missense	probably damaging	1.00
R4885:Bptf	UTSW	11	107074648	missense	probably benign	0.39
R4901:Bptf	UTSW	11	107110860	nonsense	probably null
R4995:Bptf	UTSW	11	107054565	missense	probably damaging	0.98
R5057:Bptf	UTSW	11	107082528	missense	probably damaging	0.98
R5120:Bptf	UTSW	11	107073385	missense	probably damaging	0.99
R5320:Bptf	UTSW	11	107081367	nonsense	probably null
R5329:Bptf	UTSW	11	107073295	missense	probably benign	0.06
R5418:Bptf	UTSW	11	107111294	missense	probably damaging	1.00
R5461:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R5664:Bptf	UTSW	11	107073699	missense	probably benign	0.01
R5718:Bptf	UTSW	11	107111434	missense	probably damaging	1.00
R5774:Bptf	UTSW	11	107111137	missense	probably damaging	1.00
R5851:Bptf	UTSW	11	107110862	missense	probably damaging	1.00
R5930:Bptf	UTSW	11	107073196	missense	probably damaging	1.00
R5949:Bptf	UTSW	11	107111089	missense	probably damaging	0.99
R5975:Bptf	UTSW	11	107035864	utr 3 prime	probably benign
R6027:Bptf	UTSW	11	107074945	missense	probably damaging	1.00
R6128:Bptf	UTSW	11	107074690	missense	possibly damaging	0.87
R6337:Bptf	UTSW	11	107058779	missense	possibly damaging	0.89
R6407:Bptf	UTSW	11	107111126	missense	probably damaging	1.00
R6470:Bptf	UTSW	11	107072767	missense	probably damaging	1.00
R6487:Bptf	UTSW	11	107077726	missense	probably damaging	0.99
R6501:Bptf	UTSW	11	107077683	missense	probably null	1.00
R6755:Bptf	UTSW	11	107047256	missense	probably benign	0.27
R6861:Bptf	UTSW	11	107062565	missense	probably damaging	1.00
R6866:Bptf	UTSW	11	107073580	missense	probably damaging	1.00
R6879:Bptf	UTSW	11	107042690	missense	probably benign	0.32
R6927:Bptf	UTSW	11	107054595	missense	probably damaging	1.00
R6944:Bptf	UTSW	11	107080823	missense	probably damaging	1.00
R7082:Bptf	UTSW	11	107086747	missense	probably benign	0.00
R7136:Bptf	UTSW	11	107099715	missense	probably damaging	1.00
R7162:Bptf	UTSW	11	107043631	critical splice donor site	probably null
R7171:Bptf	UTSW	11	107131407	missense	unknown
R7193:Bptf	UTSW	11	107054809	nonsense	probably null
R7210:Bptf	UTSW	11	107054464	nonsense	probably null
R7221:Bptf	UTSW	11	107054832	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107073109	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107110914	nonsense	probably null
R7422:Bptf	UTSW	11	107060558	missense	probably damaging	1.00
R7454:Bptf	UTSW	11	107044640	missense	probably benign	0.03
R7657:Bptf	UTSW	11	107074729	missense	probably damaging	1.00
R7718:Bptf	UTSW	11	107081456	missense	possibly damaging	0.65
R7827:Bptf	UTSW	11	107047187	missense	probably benign	0.01
R7844:Bptf	UTSW	11	107074061	missense	probably damaging	0.97
R7992:Bptf	UTSW	11	107110883	missense	probably benign	0.00
R8001:Bptf	UTSW	11	107047340	nonsense	probably null
R8122:Bptf	UTSW	11	107036591	critical splice acceptor site	probably null
R8235:Bptf	UTSW	11	107076632	missense	probably benign	0.04
R8308:Bptf	UTSW	11	107052989	missense	probably damaging	0.99
R8409:Bptf	UTSW	11	107062669	missense	probably damaging	1.00
R8464:Bptf	UTSW	11	107131342	missense	probably benign	0.01
R8477:Bptf	UTSW	11	107052853	missense	probably damaging	0.98
R8482:Bptf	UTSW	11	107043698	missense	probably benign	0.19
R8515:Bptf	UTSW	11	107055238	missense	possibly damaging	0.85
R8519:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R8708:Bptf	UTSW	11	107073313	missense	probably damaging	0.99
R8708:Bptf	UTSW	11	107073314	missense	probably damaging	1.00
R8722:Bptf	UTSW	11	107131469	missense	unknown
R8732:Bptf	UTSW	11	107040380	missense	probably damaging	1.00
R8783:Bptf	UTSW	11	107131531	missense	unknown
R8828:Bptf	UTSW	11	107055010	missense	probably damaging	0.98
R9004:Bptf	UTSW	11	107054887	missense	probably damaging	1.00
R9010:Bptf	UTSW	11	107073750	missense	probably damaging	1.00
R9035:Bptf	UTSW	11	107073016	missense	probably damaging	1.00
R9083:Bptf	UTSW	11	107068350	missense	probably damaging	1.00
R9211:Bptf	UTSW	11	107055298	missense	probably damaging	1.00
R9345:Bptf	UTSW	11	107080762	missense	possibly damaging	0.77
R9393:Bptf	UTSW	11	107074308	missense	probably benign	0.00
R9451:Bptf	UTSW	11	107044585	missense	probably damaging	1.00
R9561:Bptf	UTSW	11	107074128	nonsense	probably null
R9632:Bptf	UTSW	11	107061719	missense	probably damaging	1.00
R9648:Bptf	UTSW	11	107052894	missense	probably damaging	0.99
R9650:Bptf	UTSW	11	107044586	missense	probably benign	0.15
R9658:Bptf	UTSW	11	107111344	missense	probably damaging	1.00
R9775:Bptf	UTSW	11	107043676	missense	probably benign	0.04
R9776:Bptf	UTSW	11	107078570	missense	probably damaging	1.00
Z1088:Bptf	UTSW	11	107074582	missense	probably benign	0.00
Z1176:Bptf	UTSW	11	107058684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACCGCTGTTATGCTGGC -3'
(R):5'- TTGCAGGTAAGGGTGTAACAGC -3'

Sequencing Primer
(F):5'- TGGCTGGAGGCAGAGCAC -3'
(R):5'- GAGCACTGCATATTCCATGTTG -3'

Posted On

2020-01-23