Incidental Mutation 'R8037:Tmem8'
ID618309
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8037 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26117535 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 209 (L209P)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000128597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025010
AA Change: L209P

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: L209P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,293,904 W1922C probably damaging Het
Acad11 T A 9: 104,075,836 I88N possibly damaging Het
Adgrf3 A T 5: 30,199,512 C309S probably damaging Het
Ankhd1 T A 18: 36,638,623 V1343E probably damaging Het
Aqr A T 2: 114,161,680 Y72N probably damaging Het
Bptf T C 11: 107,055,950 T2339A probably damaging Het
Ccr8 T C 9: 120,094,370 F184L probably benign Het
Dbh A G 2: 27,165,688 D58G probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dhdds G A 4: 133,996,847 T52I probably benign Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Efemp2 C T 19: 5,480,113 Q290* probably null Het
Eipr1 A G 12: 28,864,677 S277G probably benign Het
Fam110b A G 4: 5,799,511 I310V possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Fsip2 T A 2: 82,985,978 N4018K possibly damaging Het
Gm12887 T A 4: 121,615,690 D85V probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6583 A G 5: 112,355,016 V274A probably benign Het
Gys2 A G 6: 142,448,393 V473A probably benign Het
Hnrnpu A T 1: 178,332,352 F388Y unknown Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ier5 A T 1: 155,099,429 M1K probably null Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Lrch1 T C 14: 74,786,354 D577G probably damaging Het
Lrrk1 A T 7: 66,285,341 M1010K probably benign Het
Mttp T G 3: 138,091,122 N873T probably damaging Het
Nphs2 A G 1: 156,310,830 R15G possibly damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1242 A T 2: 89,493,711 N200K possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pcdhga8 T C 18: 37,727,018 S376P probably damaging Het
Pde3a A G 6: 141,483,924 N737S possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Rin1 T A 19: 5,051,824 L179Q probably damaging Het
Sec63 T A 10: 42,783,487 M57K probably benign Het
Senp2 C T 16: 22,014,138 Q59* probably null Het
St8sia5 G A 18: 77,248,542 V224I possibly damaging Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tead1 A G 7: 112,759,520 D13G possibly damaging Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tnni2 A G 7: 142,443,954 R109G probably damaging Het
Unc79 A G 12: 103,049,919 K320R probably damaging Het
Vmn1r9 T A 6: 57,071,003 V21D probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACCTTACTCTCAGCTACC -3'
(R):5'- TCGCACTGGGCACTTATTTC -3'

Sequencing Primer
(F):5'- CCGACTCTAGATTCAACTCCG -3'
(R):5'- TCTCCTAACATGCTTACAGGGAG -3'
Posted On2020-01-23