Incidental Mutation 'R8037:St8sia5'
ID618312
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8037 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77248542 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 224 (V224I)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075290
AA Change: V224I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: V224I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: V188I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: V188I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,293,904 W1922C probably damaging Het
Acad11 T A 9: 104,075,836 I88N possibly damaging Het
Adgrf3 A T 5: 30,199,512 C309S probably damaging Het
Ankhd1 T A 18: 36,638,623 V1343E probably damaging Het
Aqr A T 2: 114,161,680 Y72N probably damaging Het
Bptf T C 11: 107,055,950 T2339A probably damaging Het
Ccr8 T C 9: 120,094,370 F184L probably benign Het
Dbh A G 2: 27,165,688 D58G probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dhdds G A 4: 133,996,847 T52I probably benign Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Efemp2 C T 19: 5,480,113 Q290* probably null Het
Eipr1 A G 12: 28,864,677 S277G probably benign Het
Fam110b A G 4: 5,799,511 I310V possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Fsip2 T A 2: 82,985,978 N4018K possibly damaging Het
Gm12887 T A 4: 121,615,690 D85V probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6583 A G 5: 112,355,016 V274A probably benign Het
Gys2 A G 6: 142,448,393 V473A probably benign Het
Hnrnpu A T 1: 178,332,352 F388Y unknown Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ier5 A T 1: 155,099,429 M1K probably null Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Lrch1 T C 14: 74,786,354 D577G probably damaging Het
Lrrk1 A T 7: 66,285,341 M1010K probably benign Het
Mttp T G 3: 138,091,122 N873T probably damaging Het
Nphs2 A G 1: 156,310,830 R15G possibly damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1242 A T 2: 89,493,711 N200K possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pcdhga8 T C 18: 37,727,018 S376P probably damaging Het
Pde3a A G 6: 141,483,924 N737S possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Rin1 T A 19: 5,051,824 L179Q probably damaging Het
Sec63 T A 10: 42,783,487 M57K probably benign Het
Senp2 C T 16: 22,014,138 Q59* probably null Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tead1 A G 7: 112,759,520 D13G possibly damaging Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem8 T C 17: 26,117,535 L209P possibly damaging Het
Tnni2 A G 7: 142,443,954 R109G probably damaging Het
Unc79 A G 12: 103,049,919 K320R probably damaging Het
Vmn1r9 T A 6: 57,071,003 V21D probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8153:St8sia5 UTSW 18 77253111 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTGAGTCGAATTCCCCTCG -3'
(R):5'- ATGTGGGTCTTCCTACTTCAAATG -3'

Sequencing Primer
(F):5'- CCTCGTTGGGTAGAACTTAGAG -3'
(R):5'- GTCTAGCCACTTGGGTTT -3'
Posted On2020-01-23