Incidental Mutation 'R8037:St8sia5'
ID 618312
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms ST8SiaV, Siat8e
MMRRC Submission 067474-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8037 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 77273529-77343146 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77336238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 224 (V224I)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
AlphaFold P70126
Predicted Effect possibly damaging
Transcript: ENSMUST00000075290
AA Change: V224I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: V224I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: V188I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: V188I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,243,904 (GRCm39) W1922C probably damaging Het
Acad11 T A 9: 103,953,035 (GRCm39) I88N possibly damaging Het
Adgrf3 A T 5: 30,404,510 (GRCm39) C309S probably damaging Het
Ankhd1 T A 18: 36,771,676 (GRCm39) V1343E probably damaging Het
Aqr A T 2: 113,992,161 (GRCm39) Y72N probably damaging Het
Bptf T C 11: 106,946,776 (GRCm39) T2339A probably damaging Het
Ccdc121rt3 A G 5: 112,502,882 (GRCm39) V274A probably benign Het
Ccr8 T C 9: 119,923,436 (GRCm39) F184L probably benign Het
Dbh A G 2: 27,055,700 (GRCm39) D58G probably damaging Het
Depdc5 T C 5: 33,116,692 (GRCm39) probably null Het
Dhdds G A 4: 133,724,158 (GRCm39) T52I probably benign Het
Dnmt1 A C 9: 20,852,860 (GRCm39) V82G probably damaging Het
Efemp2 C T 19: 5,530,141 (GRCm39) Q290* probably null Het
Eipr1 A G 12: 28,914,676 (GRCm39) S277G probably benign Het
Fam110b A G 4: 5,799,511 (GRCm39) I310V possibly damaging Het
Foxn4 T C 5: 114,394,658 (GRCm39) D423G probably damaging Het
Fsip2 T A 2: 82,816,322 (GRCm39) N4018K possibly damaging Het
Gm12887 T A 4: 121,472,887 (GRCm39) D85V probably damaging Het
Gys2 A G 6: 142,394,119 (GRCm39) V473A probably benign Het
Hnrnpu A T 1: 178,159,917 (GRCm39) F388Y unknown Het
Hoxa5 A G 6: 52,181,309 (GRCm39) S8P probably damaging Het
Ier5 A T 1: 154,975,175 (GRCm39) M1K probably null Het
Ighv1-52 A G 12: 115,109,210 (GRCm39) F83S probably damaging Het
Lrch1 T C 14: 75,023,794 (GRCm39) D577G probably damaging Het
Lrrk1 A T 7: 65,935,089 (GRCm39) M1010K probably benign Het
Mttp T G 3: 137,796,883 (GRCm39) N873T probably damaging Het
Nphs2 A G 1: 156,138,400 (GRCm39) R15G possibly damaging Het
Or4a70 A T 2: 89,324,055 (GRCm39) N200K possibly damaging Het
Or5d16 T C 2: 87,773,319 (GRCm39) T218A probably benign Het
Or8d6 T A 9: 39,854,177 (GRCm39) V207D probably damaging Het
Pcdhga8 T C 18: 37,860,071 (GRCm39) S376P probably damaging Het
Pde3a A G 6: 141,429,650 (GRCm39) N737S possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgap6 T C 17: 26,336,509 (GRCm39) L209P possibly damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Rin1 T A 19: 5,101,852 (GRCm39) L179Q probably damaging Het
Sec63 T A 10: 42,659,483 (GRCm39) M57K probably benign Het
Senp2 C T 16: 21,832,888 (GRCm39) Q59* probably null Het
Sycp2 A T 2: 178,045,571 (GRCm39) D16E probably damaging Het
Tab1 A G 15: 80,044,471 (GRCm39) T500A probably benign Het
Tead1 A G 7: 112,358,727 (GRCm39) D13G possibly damaging Het
Tecpr2 T C 12: 110,902,854 (GRCm39) F860L probably benign Het
Tg A G 15: 66,560,724 (GRCm39) M1029V probably benign Het
Tnni2 A G 7: 141,997,691 (GRCm39) R109G probably damaging Het
Unc79 A G 12: 103,016,178 (GRCm39) K320R probably damaging Het
Vmn1r9 T A 6: 57,047,988 (GRCm39) V21D probably benign Het
Zfp64 A G 2: 168,741,932 (GRCm39) F332S probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77,342,358 (GRCm39) missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77,342,318 (GRCm39) missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77,336,196 (GRCm39) missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77,336,157 (GRCm39) missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77,342,358 (GRCm39) missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77,342,420 (GRCm39) missense probably benign 0.13
R0392:St8sia5 UTSW 18 77,342,102 (GRCm39) missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77,333,809 (GRCm39) missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77,342,160 (GRCm39) missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77,320,502 (GRCm39) missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77,299,460 (GRCm39) critical splice donor site probably null
R2058:St8sia5 UTSW 18 77,342,459 (GRCm39) missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77,342,459 (GRCm39) missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77,320,526 (GRCm39) missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77,340,714 (GRCm39) missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77,342,478 (GRCm39) missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77,342,478 (GRCm39) missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77,333,836 (GRCm39) missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77,333,876 (GRCm39) missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77,342,238 (GRCm39) missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77,342,246 (GRCm39) missense probably benign 0.36
R8153:St8sia5 UTSW 18 77,340,807 (GRCm39) critical splice donor site probably null
R8544:St8sia5 UTSW 18 77,342,114 (GRCm39) missense probably damaging 1.00
R8858:St8sia5 UTSW 18 77,320,511 (GRCm39) missense probably benign 0.01
R8906:St8sia5 UTSW 18 77,336,172 (GRCm39) missense probably damaging 1.00
R8980:St8sia5 UTSW 18 77,333,761 (GRCm39) critical splice acceptor site probably null
R9294:St8sia5 UTSW 18 77,342,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAGTCGAATTCCCCTCG -3'
(R):5'- ATGTGGGTCTTCCTACTTCAAATG -3'

Sequencing Primer
(F):5'- CCTCGTTGGGTAGAACTTAGAG -3'
(R):5'- GTCTAGCCACTTGGGTTT -3'
Posted On 2020-01-23