Incidental Mutation 'R8038:Olfr1218'
ID618316
Institutional Source Beutler Lab
Gene Symbol Olfr1218
Ensembl Gene ENSMUSG00000075105
Gene Nameolfactory receptor 1218
SynonymsGA_x6K02T2Q125-50536041-50535106, MOR233-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8038 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89052296-89061187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89054868 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 186 (L186Q)
Ref Sequence ENSEMBL: ENSMUSP00000149558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099798] [ENSMUST00000213609] [ENSMUST00000215048] [ENSMUST00000215054]
Predicted Effect probably damaging
Transcript: ENSMUST00000099798
AA Change: L186Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097386
Gene: ENSMUSG00000075105
AA Change: L186Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.4e-45 PFAM
Pfam:7tm_1 39 286 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213609
AA Change: L186Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215048
AA Change: L186Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215054
AA Change: L186Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,215,904 M143K probably damaging Het
Accs A T 2: 93,842,917 probably null Het
Alkbh5 T C 11: 60,538,985 V188A probably damaging Het
Cacna1h C T 17: 25,375,891 V2098I probably damaging Het
Chuk A G 19: 44,078,977 Y580H probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Cops2 A T 2: 125,832,286 H420Q probably benign Het
Ctcfl A T 2: 173,101,905 C551S probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Fam90a1a A T 8: 21,963,439 N270I possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ighe A T 12: 113,269,433 V456D Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Itga2 A T 13: 114,853,755 N921K probably damaging Het
Kdm2b T C 5: 122,960,895 probably benign Het
Llgl2 T G 11: 115,851,103 M657R probably benign Het
Lrrcc1 T A 3: 14,565,830 I1019K possibly damaging Het
Lrriq3 A T 3: 155,164,001 D321V probably benign Het
Lsm10 T C 4: 126,098,097 V82A probably damaging Het
Mettl3 A G 14: 52,299,964 S154P possibly damaging Het
Naip2 T C 13: 100,162,062 I489V probably benign Het
Nat8f5 T A 6: 85,817,685 T98S possibly damaging Het
Olfr1490 G A 19: 13,655,355 V309M possibly damaging Het
Olfr857 G T 9: 19,713,680 M284I possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pld5 T C 1: 176,044,897 I225V probably benign Het
Ppfia1 C A 7: 144,514,916 A414S possibly damaging Het
Ppib T C 9: 66,060,333 V23A probably benign Het
Rabggta A T 14: 55,718,930 S361T probably benign Het
Rap1gap2 T C 11: 74,392,283 S664G probably benign Het
Recql5 A G 11: 115,927,352 V285A possibly damaging Het
Rtn4rl1 G C 11: 75,265,881 E380Q possibly damaging Het
Scarb2 A T 5: 92,451,448 S338T probably damaging Het
Skint4 T G 4: 112,119,806 probably benign Het
Slc13a5 T C 11: 72,253,370 K294R probably benign Het
Spib A G 7: 44,529,886 F32S probably benign Het
Spint2 A G 7: 29,260,129 probably benign Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem126b C T 7: 90,469,622 V153I probably benign Het
Uba2 A T 7: 34,147,597 Y440N probably damaging Het
Vwa2 A G 19: 56,897,888 E129G probably benign Het
Wapl A G 14: 34,691,682 D167G probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Zfp786 C T 6: 47,821,254 R250H probably benign Het
Other mutations in Olfr1218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Olfr1218 APN 2 89054569 missense probably damaging 1.00
IGL03089:Olfr1218 APN 2 89055013 missense probably benign 0.34
IGL03387:Olfr1218 APN 2 89055113 missense probably damaging 1.00
R0350:Olfr1218 UTSW 2 89055356 missense probably benign 0.10
R0699:Olfr1218 UTSW 2 89055292 missense possibly damaging 0.67
R1609:Olfr1218 UTSW 2 89055344 missense probably benign
R1856:Olfr1218 UTSW 2 89054859 missense possibly damaging 0.95
R1972:Olfr1218 UTSW 2 89054547 missense probably benign 0.05
R2066:Olfr1218 UTSW 2 89054899 missense probably damaging 0.99
R2921:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R2923:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R4037:Olfr1218 UTSW 2 89054688 missense probably damaging 0.99
R4585:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R4586:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R5041:Olfr1218 UTSW 2 89054921 nonsense probably null
R5124:Olfr1218 UTSW 2 89055087 missense probably damaging 0.96
R5138:Olfr1218 UTSW 2 89054947 missense probably benign 0.00
R5415:Olfr1218 UTSW 2 89054896 missense probably benign 0.00
R5501:Olfr1218 UTSW 2 89054886 nonsense probably null
R5941:Olfr1218 UTSW 2 89054619 missense probably benign
R5991:Olfr1218 UTSW 2 89054782 missense probably benign 0.01
R6396:Olfr1218 UTSW 2 89055297 missense probably benign 0.36
R7047:Olfr1218 UTSW 2 89055146 missense probably damaging 0.98
R8387:Olfr1218 UTSW 2 89055302 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACTACAACAGTAACGTGGGCTC -3'
(R):5'- TAGCAGCCATGGCCTATGAC -3'

Sequencing Primer
(F):5'- GGCTCTCAGAGAGAACAAA -3'
(R):5'- ACGTGGCTATTTGCAAGCC -3'
Posted On2020-01-23