Incidental Mutation 'R8038:Hoxa5'
ID618329
Institutional Source Beutler Lab
Gene Symbol Hoxa5
Ensembl Gene ENSMUSG00000038253
Gene Namehomeobox A5
SynonymsHox-1.3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R8038 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location52201754-52204587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52204329 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 8 (S8P)
Ref Sequence ENSEMBL: ENSMUSP00000039012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048794] [ENSMUST00000062829] [ENSMUST00000114434] [ENSMUST00000128102]
Predicted Effect probably damaging
Transcript: ENSMUST00000048794
AA Change: S8P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039012
Gene: ENSMUSG00000038253
AA Change: S8P

DomainStartEndE-ValueType
low complexity region 65 86 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 146 175 N/A INTRINSIC
HOX 195 257 1.63e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062829
SMART Domains Protein: ENSMUSP00000058755
Gene: ENSMUSG00000043219

DomainStartEndE-ValueType
HOX 154 216 2.43e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show skeletal defects, tracheal and lung dysmorphology, reduced surfactant production, emphysema, and partial neonatal lethality. Survivors show stunted growth, delayed ear elevation and eyelid opening, and altered thyroid development, digestive secretion, and ovarian biology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,215,904 M143K probably damaging Het
Accs A T 2: 93,842,917 probably null Het
Alkbh5 T C 11: 60,538,985 V188A probably damaging Het
Cacna1h C T 17: 25,375,891 V2098I probably damaging Het
Chuk A G 19: 44,078,977 Y580H probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Cops2 A T 2: 125,832,286 H420Q probably benign Het
Ctcfl A T 2: 173,101,905 C551S probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Fam90a1a A T 8: 21,963,439 N270I possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Ighe A T 12: 113,269,433 V456D Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Itga2 A T 13: 114,853,755 N921K probably damaging Het
Kdm2b T C 5: 122,960,895 probably benign Het
Llgl2 T G 11: 115,851,103 M657R probably benign Het
Lrrcc1 T A 3: 14,565,830 I1019K possibly damaging Het
Lrriq3 A T 3: 155,164,001 D321V probably benign Het
Lsm10 T C 4: 126,098,097 V82A probably damaging Het
Mettl3 A G 14: 52,299,964 S154P possibly damaging Het
Naip2 T C 13: 100,162,062 I489V probably benign Het
Nat8f5 T A 6: 85,817,685 T98S possibly damaging Het
Olfr1218 A T 2: 89,054,868 L186Q probably damaging Het
Olfr1490 G A 19: 13,655,355 V309M possibly damaging Het
Olfr857 G T 9: 19,713,680 M284I possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pld5 T C 1: 176,044,897 I225V probably benign Het
Ppfia1 C A 7: 144,514,916 A414S possibly damaging Het
Ppib T C 9: 66,060,333 V23A probably benign Het
Rabggta A T 14: 55,718,930 S361T probably benign Het
Rap1gap2 T C 11: 74,392,283 S664G probably benign Het
Recql5 A G 11: 115,927,352 V285A possibly damaging Het
Rtn4rl1 G C 11: 75,265,881 E380Q possibly damaging Het
Scarb2 A T 5: 92,451,448 S338T probably damaging Het
Skint4 T G 4: 112,119,806 probably benign Het
Slc13a5 T C 11: 72,253,370 K294R probably benign Het
Spib A G 7: 44,529,886 F32S probably benign Het
Spint2 A G 7: 29,260,129 probably benign Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem126b C T 7: 90,469,622 V153I probably benign Het
Uba2 A T 7: 34,147,597 Y440N probably damaging Het
Vwa2 A G 19: 56,897,888 E129G probably benign Het
Wapl A G 14: 34,691,682 D167G probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Zfp786 C T 6: 47,821,254 R250H probably benign Het
Other mutations in Hoxa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Hoxa5 APN 6 52204331 missense probably damaging 1.00
IGL01885:Hoxa5 APN 6 52202667 missense probably damaging 1.00
IGL02021:Hoxa5 APN 6 52202657 missense probably damaging 1.00
IGL02631:Hoxa5 APN 6 52203810 missense probably damaging 1.00
IGL02885:Hoxa5 APN 6 52202708 missense probably damaging 1.00
R0377:Hoxa5 UTSW 6 52202646 missense probably damaging 1.00
R0543:Hoxa5 UTSW 6 52204340 missense probably damaging 1.00
R1061:Hoxa5 UTSW 6 52204155 missense probably benign
R1460:Hoxa5 UTSW 6 52203948 missense probably benign 0.00
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1804:Hoxa5 UTSW 6 52202648 missense probably damaging 1.00
R1822:Hoxa5 UTSW 6 52202732 missense probably damaging 1.00
R2332:Hoxa5 UTSW 6 52202679 missense probably damaging 1.00
R4303:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
R4796:Hoxa5 UTSW 6 52203963 missense probably benign 0.01
R5642:Hoxa5 UTSW 6 52204217 missense probably damaging 1.00
R6212:Hoxa5 UTSW 6 52202714 missense probably damaging 1.00
R7134:Hoxa5 UTSW 6 52204043 missense probably damaging 1.00
R7172:Hoxa5 UTSW 6 52204296 missense probably damaging 1.00
R8037:Hoxa5 UTSW 6 52204329 missense probably damaging 1.00
R8199:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGACTAATGTGCAGCTTGC -3'
(R):5'- GTGATTCGAAGTCGTACCCC -3'

Sequencing Primer
(F):5'- TGCCCAGGGAGTTTTTCC -3'
(R):5'- GATTCGAAGTCGTACCCCATATTTGG -3'
Posted On2020-01-23