Incidental Mutation 'R0661:Heyl'
ID61834
Institutional Source Beutler Lab
Gene Symbol Heyl
Ensembl Gene ENSMUSG00000032744
Gene Namehairy/enhancer-of-split related with YRPW motif-like
SynonymsHrt3, bHLHb33, Hey3, Hesr3
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0661 (G1)
Quality Score116
Status Not validated
Chromosome4
Chromosomal Location123233556-123249875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123246031 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 128 (V128F)
Ref Sequence ENSEMBL: ENSMUSP00000040576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040821]
Predicted Effect probably damaging
Transcript: ENSMUST00000040821
AA Change: V128F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040576
Gene: ENSMUSG00000032744
AA Change: V128F

DomainStartEndE-ValueType
HLH 49 104 8.72e-15 SMART
ORANGE 114 162 1.72e-14 SMART
low complexity region 205 215 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127172
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The sequence of the encoded protein contains a conserved bHLH and orange domain, but its YRPW motif has diverged from other HESR family members. It is thought to be an effector of Notch signaling and a regulator of cell fate decisions. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced TrkC+ sensory neurons in the dorsal root ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Heyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Heyl APN 4 123246630 makesense probably null
IGL01420:Heyl APN 4 123240174 missense probably damaging 1.00
IGL01897:Heyl APN 4 123246607 missense probably damaging 0.99
IGL02130:Heyl APN 4 123246271 missense probably benign 0.00
R0347:Heyl UTSW 4 123233940 missense probably benign 0.27
R1559:Heyl UTSW 4 123241399 missense probably damaging 1.00
R1840:Heyl UTSW 4 123241390 missense probably damaging 1.00
R2044:Heyl UTSW 4 123241363 missense probably damaging 1.00
R2132:Heyl UTSW 4 123246083 missense probably damaging 1.00
R7151:Heyl UTSW 4 123246461 missense probably benign 0.00
Z1088:Heyl UTSW 4 123240181 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATTCAGGTGCAGCAGGTCCCATAG -3'
(R):5'- GTCATCAGATTTCCCAGCTCCAGG -3'

Sequencing Primer
(F):5'- AGCAGGTCCCATAGGGTTTC -3'
(R):5'- AACAAATTCCGCCGGGTTG -3'
Posted On2013-07-30