Incidental Mutation 'R8038:Wapl'
ID 618354
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 067475-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8038 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34413639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,106,730 (GRCm39) M143K probably damaging Het
Accs A T 2: 93,673,262 (GRCm39) probably null Het
Alkbh5 T C 11: 60,429,811 (GRCm39) V188A probably damaging Het
Cacna1h C T 17: 25,594,865 (GRCm39) V2098I probably damaging Het
Chuk A G 19: 44,067,416 (GRCm39) Y580H probably damaging Het
Col7a1 A G 9: 108,786,360 (GRCm39) N530S unknown Het
Cops2 A T 2: 125,674,206 (GRCm39) H420Q probably benign Het
Ctcfl A T 2: 172,943,698 (GRCm39) C551S probably damaging Het
Depdc5 T C 5: 33,116,692 (GRCm39) probably null Het
Dnmt1 A C 9: 20,852,860 (GRCm39) V82G probably damaging Het
Fam90a1a A T 8: 22,453,455 (GRCm39) N270I possibly damaging Het
Foxn4 T C 5: 114,394,658 (GRCm39) D423G probably damaging Het
Hoxa5 A G 6: 52,181,309 (GRCm39) S8P probably damaging Het
Ighe A T 12: 113,233,053 (GRCm39) V456D Het
Ighv1-52 A G 12: 115,109,210 (GRCm39) F83S probably damaging Het
Itga2 A T 13: 114,990,291 (GRCm39) N921K probably damaging Het
Kdm2b T C 5: 123,098,958 (GRCm39) probably benign Het
Llgl2 T G 11: 115,741,929 (GRCm39) M657R probably benign Het
Lrrcc1 T A 3: 14,630,890 (GRCm39) I1019K possibly damaging Het
Lrriq3 A T 3: 154,869,638 (GRCm39) D321V probably benign Het
Lsm10 T C 4: 125,991,890 (GRCm39) V82A probably damaging Het
Mettl3 A G 14: 52,537,421 (GRCm39) S154P possibly damaging Het
Naip2 T C 13: 100,298,570 (GRCm39) I489V probably benign Het
Nat8f5 T A 6: 85,794,667 (GRCm39) T98S possibly damaging Het
Or10w1 G A 19: 13,632,719 (GRCm39) V309M possibly damaging Het
Or4c113 A T 2: 88,885,212 (GRCm39) L186Q probably damaging Het
Or7e166 G T 9: 19,624,976 (GRCm39) M284I possibly damaging Het
Or8d6 T A 9: 39,854,177 (GRCm39) V207D probably damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Pld5 T C 1: 175,872,463 (GRCm39) I225V probably benign Het
Ppfia1 C A 7: 144,068,653 (GRCm39) A414S possibly damaging Het
Ppib T C 9: 65,967,615 (GRCm39) V23A probably benign Het
Rabggta A T 14: 55,956,387 (GRCm39) S361T probably benign Het
Rap1gap2 T C 11: 74,283,109 (GRCm39) S664G probably benign Het
Recql5 A G 11: 115,818,178 (GRCm39) V285A possibly damaging Het
Rtn4rl1 G C 11: 75,156,707 (GRCm39) E380Q possibly damaging Het
Scarb2 A T 5: 92,599,307 (GRCm39) S338T probably damaging Het
Skint4 T G 4: 111,977,003 (GRCm39) probably benign Het
Slc13a5 T C 11: 72,144,196 (GRCm39) K294R probably benign Het
Spib A G 7: 44,179,310 (GRCm39) F32S probably benign Het
Spint2 A G 7: 28,959,554 (GRCm39) probably benign Het
Sycp2 A T 2: 178,045,571 (GRCm39) D16E probably damaging Het
Tab1 A G 15: 80,044,471 (GRCm39) T500A probably benign Het
Tecpr2 T C 12: 110,902,854 (GRCm39) F860L probably benign Het
Tg A G 15: 66,560,724 (GRCm39) M1029V probably benign Het
Tmem126b C T 7: 90,118,830 (GRCm39) V153I probably benign Het
Uba2 A T 7: 33,847,022 (GRCm39) Y440N probably damaging Het
Vwa2 A G 19: 56,886,320 (GRCm39) E129G probably benign Het
Zfp64 A G 2: 168,741,932 (GRCm39) F332S probably damaging Het
Zfp786 C T 6: 47,798,188 (GRCm39) R250H probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- GACATGGCAGCTGTACCTAC -3'
(R):5'- TTTTCCAGACTGGGAGTTCC -3'

Sequencing Primer
(F):5'- ATGGCAGCTGTACCTACTGACAG -3'
(R):5'- CTGGGAGTTCCAAGTATCATTTG -3'
Posted On 2020-01-23