Incidental Mutation 'R8038:Wapl'
ID618354
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8038 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34691682 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect probably benign
Transcript: ENSMUST00000048263
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090027
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169910
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,215,904 M143K probably damaging Het
Accs A T 2: 93,842,917 probably null Het
Alkbh5 T C 11: 60,538,985 V188A probably damaging Het
Cacna1h C T 17: 25,375,891 V2098I probably damaging Het
Chuk A G 19: 44,078,977 Y580H probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Cops2 A T 2: 125,832,286 H420Q probably benign Het
Ctcfl A T 2: 173,101,905 C551S probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Fam90a1a A T 8: 21,963,439 N270I possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ighe A T 12: 113,269,433 V456D Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Itga2 A T 13: 114,853,755 N921K probably damaging Het
Llgl2 T G 11: 115,851,103 M657R probably benign Het
Lrrcc1 T A 3: 14,565,830 I1019K possibly damaging Het
Lrriq3 A T 3: 155,164,001 D321V probably benign Het
Lsm10 T C 4: 126,098,097 V82A probably damaging Het
Mettl3 A G 14: 52,299,964 S154P possibly damaging Het
Naip2 T C 13: 100,162,062 I489V probably benign Het
Nat8f5 T A 6: 85,817,685 T98S possibly damaging Het
Olfr1218 A T 2: 89,054,868 L186Q probably damaging Het
Olfr1490 G A 19: 13,655,355 V309M possibly damaging Het
Olfr857 G T 9: 19,713,680 M284I possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pld5 T C 1: 176,044,897 I225V probably benign Het
Ppfia1 C A 7: 144,514,916 A414S possibly damaging Het
Ppib T C 9: 66,060,333 V23A probably benign Het
Rabggta A T 14: 55,718,930 S361T probably benign Het
Rap1gap2 T C 11: 74,392,283 S664G probably benign Het
Recql5 A G 11: 115,927,352 V285A possibly damaging Het
Rtn4rl1 G C 11: 75,265,881 E380Q possibly damaging Het
Scarb2 A T 5: 92,451,448 S338T probably damaging Het
Slc13a5 T C 11: 72,253,370 K294R probably benign Het
Spib A G 7: 44,529,886 F32S probably benign Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem126b C T 7: 90,469,622 V153I probably benign Het
Uba2 A T 7: 34,147,597 Y440N probably damaging Het
Vwa2 A G 19: 56,897,888 E129G probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Zfp786 C T 6: 47,821,254 R250H probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- GACATGGCAGCTGTACCTAC -3'
(R):5'- TTTTCCAGACTGGGAGTTCC -3'

Sequencing Primer
(F):5'- ATGGCAGCTGTACCTACTGACAG -3'
(R):5'- CTGGGAGTTCCAAGTATCATTTG -3'
Posted On2020-01-23