Incidental Mutation 'R8038:Mettl3'
ID618355
Institutional Source Beutler Lab
Gene Symbol Mettl3
Ensembl Gene ENSMUSG00000022160
Gene Namemethyltransferase like 3
SynonymsM6A, 2310024F18Rik, Spo8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8038 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52294841-52305128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52299964 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 154 (S154P)
Ref Sequence ENSEMBL: ENSMUSP00000022767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766] [ENSMUST00000022767] [ENSMUST00000122962] [ENSMUST00000145875] [ENSMUST00000147768] [ENSMUST00000173138] [ENSMUST00000173896] [ENSMUST00000174351] [ENSMUST00000174853]
Predicted Effect probably benign
Transcript: ENSMUST00000022766
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000022767
AA Change: S154P

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022767
Gene: ENSMUSG00000022160
AA Change: S154P

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
Pfam:MT-A70 389 550 9.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122962
Predicted Effect probably benign
Transcript: ENSMUST00000145875
Predicted Effect probably damaging
Transcript: ENSMUST00000147768
AA Change: S154P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134577
Gene: ENSMUSG00000022160
AA Change: S154P

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173138
SMART Domains Protein: ENSMUSP00000134018
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173656
SMART Domains Protein: ENSMUSP00000133759
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 60 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173896
SMART Domains Protein: ENSMUSP00000133506
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174351
AA Change: S103P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134732
Gene: ENSMUSG00000022160
AA Change: S103P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 140 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174360
SMART Domains Protein: ENSMUSP00000134578
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 34 4.3e-10 PFAM
Pfam:MT-A70 30 74 1.4e-15 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133864
Gene: ENSMUSG00000022160
AA Change: S83P

DomainStartEndE-ValueType
low complexity region 120 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 with a deficiency in adopting the epiblast egg cylinder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,215,904 M143K probably damaging Het
Accs A T 2: 93,842,917 probably null Het
Alkbh5 T C 11: 60,538,985 V188A probably damaging Het
Cacna1h C T 17: 25,375,891 V2098I probably damaging Het
Chuk A G 19: 44,078,977 Y580H probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Cops2 A T 2: 125,832,286 H420Q probably benign Het
Ctcfl A T 2: 173,101,905 C551S probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Fam90a1a A T 8: 21,963,439 N270I possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ighe A T 12: 113,269,433 V456D Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Itga2 A T 13: 114,853,755 N921K probably damaging Het
Kdm2b T C 5: 122,960,895 probably benign Het
Llgl2 T G 11: 115,851,103 M657R probably benign Het
Lrrcc1 T A 3: 14,565,830 I1019K possibly damaging Het
Lrriq3 A T 3: 155,164,001 D321V probably benign Het
Lsm10 T C 4: 126,098,097 V82A probably damaging Het
Naip2 T C 13: 100,162,062 I489V probably benign Het
Nat8f5 T A 6: 85,817,685 T98S possibly damaging Het
Olfr1218 A T 2: 89,054,868 L186Q probably damaging Het
Olfr1490 G A 19: 13,655,355 V309M possibly damaging Het
Olfr857 G T 9: 19,713,680 M284I possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pld5 T C 1: 176,044,897 I225V probably benign Het
Ppfia1 C A 7: 144,514,916 A414S possibly damaging Het
Ppib T C 9: 66,060,333 V23A probably benign Het
Rabggta A T 14: 55,718,930 S361T probably benign Het
Rap1gap2 T C 11: 74,392,283 S664G probably benign Het
Recql5 A G 11: 115,927,352 V285A possibly damaging Het
Rtn4rl1 G C 11: 75,265,881 E380Q possibly damaging Het
Scarb2 A T 5: 92,451,448 S338T probably damaging Het
Skint4 T G 4: 112,119,806 probably benign Het
Slc13a5 T C 11: 72,253,370 K294R probably benign Het
Spib A G 7: 44,529,886 F32S probably benign Het
Spint2 A G 7: 29,260,129 probably benign Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem126b C T 7: 90,469,622 V153I probably benign Het
Uba2 A T 7: 34,147,597 Y440N probably damaging Het
Vwa2 A G 19: 56,897,888 E129G probably benign Het
Wapl A G 14: 34,691,682 D167G probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Zfp786 C T 6: 47,821,254 R250H probably benign Het
Other mutations in Mettl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Mettl3 APN 14 52296967 unclassified probably benign
IGL00508:Mettl3 APN 14 52294979 unclassified probably benign
R0417:Mettl3 UTSW 14 52296698 missense probably damaging 1.00
R1533:Mettl3 UTSW 14 52296928 missense probably benign 0.01
R2113:Mettl3 UTSW 14 52294984 makesense probably null
R3785:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R3786:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R4651:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4652:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4938:Mettl3 UTSW 14 52299727 missense probably damaging 1.00
R5462:Mettl3 UTSW 14 52299879 missense probably damaging 0.96
R6046:Mettl3 UTSW 14 52298786 missense possibly damaging 0.91
R6151:Mettl3 UTSW 14 52295020 missense probably damaging 1.00
R6169:Mettl3 UTSW 14 52298757 missense possibly damaging 0.88
R6225:Mettl3 UTSW 14 52296758 unclassified probably null
R6282:Mettl3 UTSW 14 52297971 missense probably benign 0.01
R8110:Mettl3 UTSW 14 52300252 missense probably benign 0.02
RF001:Mettl3 UTSW 14 52300299 missense probably benign
X0025:Mettl3 UTSW 14 52298088 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGATCAACATCGGAGGCAGC -3'
(R):5'- TGCCATCTCTACGGTAATCACC -3'

Sequencing Primer
(F):5'- GCAGCGTGCTTCCTTGAC -3'
(R):5'- CGGTAATCACCTGATGAAATTGG -3'
Posted On2020-01-23