Incidental Mutation 'R0661:C1ra'
List |< first << previous [record 7 of 42] next >> last >|
ID61836
Institutional Source Beutler Lab
Gene Symbol C1ra
Ensembl Gene ENSMUSG00000055172
Gene Namecomplement component 1, r subcomponent A
SynonymsmC1rA
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0661 (G1)
Quality Score127
Status Not validated
Chromosome6
Chromosomal Location124512405-124523443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124522377 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 507 (H507Q)
Ref Sequence ENSEMBL: ENSMUSP00000063707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068593]
Predicted Effect probably benign
Transcript: ENSMUST00000068593
AA Change: H507Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172
AA Change: H507Q

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in C1ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:C1ra APN 6 124522291 missense probably benign 0.00
IGL03079:C1ra APN 6 124519835 missense probably damaging 1.00
IGL03151:C1ra APN 6 124519771 missense probably benign 0.09
mueller-eberhardt UTSW 6 124512801 critical splice donor site probably null
pillemer UTSW 6 124516724 missense probably damaging 1.00
R0331:C1ra UTSW 6 124519435 splice site probably null
R0457:C1ra UTSW 6 124522753 missense probably benign
R0472:C1ra UTSW 6 124517444 missense possibly damaging 0.95
R0570:C1ra UTSW 6 124513705 missense probably benign 0.00
R0634:C1ra UTSW 6 124517505 missense possibly damaging 0.49
R1451:C1ra UTSW 6 124521641 missense probably benign 0.04
R1640:C1ra UTSW 6 124522274 missense probably benign 0.17
R1698:C1ra UTSW 6 124522766 missense probably benign 0.05
R4020:C1ra UTSW 6 124519777 missense probably benign 0.01
R4801:C1ra UTSW 6 124513768 missense probably benign 0.00
R4802:C1ra UTSW 6 124513768 missense probably benign 0.00
R4909:C1ra UTSW 6 124522334 missense probably damaging 1.00
R5086:C1ra UTSW 6 124519729 missense probably damaging 1.00
R5108:C1ra UTSW 6 124522922 missense probably damaging 1.00
R5372:C1ra UTSW 6 124521625 missense probably damaging 1.00
R5421:C1ra UTSW 6 124522790 missense probably benign 0.36
R5635:C1ra UTSW 6 124516724 missense probably damaging 1.00
R6438:C1ra UTSW 6 124513777 missense possibly damaging 0.54
R6518:C1ra UTSW 6 124521575 splice site probably null
R6738:C1ra UTSW 6 124517759 missense probably damaging 1.00
R6804:C1ra UTSW 6 124517725 missense probably benign
R6805:C1ra UTSW 6 124517725 missense probably benign
R6939:C1ra UTSW 6 124512801 critical splice donor site probably null
R6981:C1ra UTSW 6 124517725 missense probably benign
R6982:C1ra UTSW 6 124517725 missense probably benign
R7056:C1ra UTSW 6 124517725 missense probably benign
R7057:C1ra UTSW 6 124517725 missense probably benign
R7094:C1ra UTSW 6 124517725 missense probably benign
R7468:C1ra UTSW 6 124522444 nonsense probably null
R7476:C1ra UTSW 6 124522699 missense probably damaging 1.00
R7478:C1ra UTSW 6 124517725 missense probably benign
R7479:C1ra UTSW 6 124517725 missense probably benign
R7481:C1ra UTSW 6 124517725 missense probably benign
R7512:C1ra UTSW 6 124517725 missense probably benign
R7725:C1ra UTSW 6 124517725 missense probably benign
R7728:C1ra UTSW 6 124517725 missense probably benign
R7730:C1ra UTSW 6 124517725 missense probably benign
R7818:C1ra UTSW 6 124517725 missense probably benign
R7819:C1ra UTSW 6 124517725 missense probably benign
R7835:C1ra UTSW 6 124517725 missense probably benign
R7854:C1ra UTSW 6 124517741 missense probably benign 0.00
R7876:C1ra UTSW 6 124517725 missense probably benign
R7877:C1ra UTSW 6 124517725 missense probably benign
R7881:C1ra UTSW 6 124517725 missense probably benign
R7883:C1ra UTSW 6 124517725 missense probably benign
R7892:C1ra UTSW 6 124519415 missense probably benign 0.07
R7899:C1ra UTSW 6 124517725 missense probably benign
R7901:C1ra UTSW 6 124517725 missense probably benign
R7902:C1ra UTSW 6 124517725 missense probably benign
R7903:C1ra UTSW 6 124517725 missense probably benign
R7947:C1ra UTSW 6 124517379 missense probably benign 0.02
R8087:C1ra UTSW 6 124513872 missense probably damaging 1.00
R8098:C1ra UTSW 6 124517725 missense probably benign
R8099:C1ra UTSW 6 124517725 missense probably benign
R8271:C1ra UTSW 6 124522651 missense probably damaging 1.00
R8300:C1ra UTSW 6 124521638 missense probably benign 0.04
X0062:C1ra UTSW 6 124522439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACACAGAAGGAGCGCATC -3'
(R):5'- CGAATCCGCTGACATAACCCATGAG -3'

Sequencing Primer
(F):5'- CATCATCAGAGGGCAGCCAG -3'
(R):5'- GGCCATAGAAGGTCTCATTGTC -3'
Posted On2013-07-30