Incidental Mutation 'R8038:Olfr1490'
ID618360
Institutional Source Beutler Lab
Gene Symbol Olfr1490
Ensembl Gene ENSMUSG00000061387
Gene Nameolfactory receptor 1490
SynonymsMOR266-6P, GA_x6K02T2RE5P-3987000-3987950
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8038 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13651091-13659545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13655355 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 309 (V309M)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000213900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080162
AA Change: V304M

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: V304M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213900
AA Change: V309M

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,215,904 M143K probably damaging Het
Accs A T 2: 93,842,917 probably null Het
Alkbh5 T C 11: 60,538,985 V188A probably damaging Het
Cacna1h C T 17: 25,375,891 V2098I probably damaging Het
Chuk A G 19: 44,078,977 Y580H probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Cops2 A T 2: 125,832,286 H420Q probably benign Het
Ctcfl A T 2: 173,101,905 C551S probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Fam90a1a A T 8: 21,963,439 N270I possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ighe A T 12: 113,269,433 V456D Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Itga2 A T 13: 114,853,755 N921K probably damaging Het
Kdm2b T C 5: 122,960,895 probably benign Het
Llgl2 T G 11: 115,851,103 M657R probably benign Het
Lrrcc1 T A 3: 14,565,830 I1019K possibly damaging Het
Lrriq3 A T 3: 155,164,001 D321V probably benign Het
Lsm10 T C 4: 126,098,097 V82A probably damaging Het
Mettl3 A G 14: 52,299,964 S154P possibly damaging Het
Naip2 T C 13: 100,162,062 I489V probably benign Het
Nat8f5 T A 6: 85,817,685 T98S possibly damaging Het
Olfr1218 A T 2: 89,054,868 L186Q probably damaging Het
Olfr857 G T 9: 19,713,680 M284I possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pld5 T C 1: 176,044,897 I225V probably benign Het
Ppfia1 C A 7: 144,514,916 A414S possibly damaging Het
Ppib T C 9: 66,060,333 V23A probably benign Het
Rabggta A T 14: 55,718,930 S361T probably benign Het
Rap1gap2 T C 11: 74,392,283 S664G probably benign Het
Recql5 A G 11: 115,927,352 V285A possibly damaging Het
Rtn4rl1 G C 11: 75,265,881 E380Q possibly damaging Het
Scarb2 A T 5: 92,451,448 S338T probably damaging Het
Skint4 T G 4: 112,119,806 probably benign Het
Slc13a5 T C 11: 72,253,370 K294R probably benign Het
Spib A G 7: 44,529,886 F32S probably benign Het
Spint2 A G 7: 29,260,129 probably benign Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem126b C T 7: 90,469,622 V153I probably benign Het
Uba2 A T 7: 34,147,597 Y440N probably damaging Het
Vwa2 A G 19: 56,897,888 E129G probably benign Het
Wapl A G 14: 34,691,682 D167G probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Zfp786 C T 6: 47,821,254 R250H probably benign Het
Other mutations in Olfr1490
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr1490 APN 19 13654933 missense probably damaging 0.96
IGL01335:Olfr1490 APN 19 13655176 missense probably damaging 1.00
IGL01561:Olfr1490 APN 19 13654905 missense probably benign
IGL01644:Olfr1490 APN 19 13655404 utr 3 prime probably benign
IGL02257:Olfr1490 APN 19 13655265 missense probably benign
IGL02282:Olfr1490 APN 19 13655258 missense probably damaging 1.00
IGL02355:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02362:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02639:Olfr1490 APN 19 13654596 missense possibly damaging 0.73
R0078:Olfr1490 UTSW 19 13654815 missense probably benign 0.00
R0278:Olfr1490 UTSW 19 13654764 missense probably damaging 1.00
R0278:Olfr1490 UTSW 19 13654765 missense probably damaging 1.00
R0506:Olfr1490 UTSW 19 13654897 missense possibly damaging 0.62
R0927:Olfr1490 UTSW 19 13654452 missense probably damaging 0.99
R1087:Olfr1490 UTSW 19 13655012 nonsense probably null
R1762:Olfr1490 UTSW 19 13654504 missense probably benign
R2901:Olfr1490 UTSW 19 13654945 missense probably damaging 1.00
R2907:Olfr1490 UTSW 19 13655247 missense possibly damaging 0.84
R3625:Olfr1490 UTSW 19 13654982 nonsense probably null
R3838:Olfr1490 UTSW 19 13654957 missense probably benign 0.00
R4745:Olfr1490 UTSW 19 13655386 missense probably benign
R4804:Olfr1490 UTSW 19 13654518 missense probably benign
R5026:Olfr1490 UTSW 19 13654932 missense probably benign 0.03
R5314:Olfr1490 UTSW 19 13655266 missense probably benign 0.08
R6052:Olfr1490 UTSW 19 13654507 missense possibly damaging 0.95
R6235:Olfr1490 UTSW 19 13654781 nonsense probably null
R7405:Olfr1490 UTSW 19 13654882 missense probably benign 0.14
R7557:Olfr1490 UTSW 19 13655026 missense possibly damaging 0.71
R8338:Olfr1490 UTSW 19 13654852 missense possibly damaging 0.92
R8366:Olfr1490 UTSW 19 13654539 missense probably damaging 1.00
Z1176:Olfr1490 UTSW 19 13654463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGGCCTTCAACACTTGTTC -3'
(R):5'- CTATCAACCAGTACAAATGTTGCAC -3'

Sequencing Primer
(F):5'- AACACTTGTTCTTCCCACCTCAC -3'
(R):5'- CCAGTACAAATGTTGCACATATTAAG -3'
Posted On2020-01-23