Incidental Mutation 'R8039:Or6y1'
ID 618368
Institutional Source Beutler Lab
Gene Symbol Or6y1
Ensembl Gene ENSMUSG00000066671
Gene Name olfactory receptor family 6 subfamily Y member 1
Synonyms EG546747, Olfr413-ps1, GA_x6K02T2P20D-20731742-20730694, Olfr220, MOR103-13P, MOR103-17, GA_x6K02SYWY4V-595-239
MMRRC Submission 067476-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 174276191-174277168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 174277162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 324 (S324R)
Ref Sequence ENSEMBL: ENSMUSP00000141919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085861] [ENSMUST00000194229]
AlphaFold E9Q050
Predicted Effect unknown
Transcript: ENSMUST00000085861
AA Change: S324R
SMART Domains Protein: ENSMUSP00000083023
Gene: ENSMUSG00000066671
AA Change: S324R

DomainStartEndE-ValueType
Pfam:7tm_4 36 314 1.2e-51 PFAM
Pfam:7tm_1 46 295 3.6e-25 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194229
AA Change: S324R
SMART Domains Protein: ENSMUSP00000141919
Gene: ENSMUSG00000066671
AA Change: S324R

DomainStartEndE-ValueType
Pfam:7tm_1 46 295 6e-33 PFAM
Pfam:7tm_4 144 288 1.4e-44 PFAM
low complexity region 315 325 N/A INTRINSIC
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,699 (GRCm39) H225R probably damaging Het
Adgrb2 T A 4: 129,916,061 (GRCm39) L1451Q probably damaging Het
Afdn T C 17: 14,119,403 (GRCm39) L1713P probably damaging Het
Agr2 A T 12: 36,045,558 (GRCm39) I15F probably benign Het
Agrn T C 4: 156,253,468 (GRCm39) T1808A probably benign Het
Akap6 A G 12: 53,188,459 (GRCm39) I1958V probably benign Het
Ankrd60 C A 2: 173,414,284 (GRCm39) probably null Het
Anpep A G 7: 79,489,148 (GRCm39) probably null Het
Apoa4 A T 9: 46,153,591 (GRCm39) D64V possibly damaging Het
Arhgef26 C A 3: 62,247,351 (GRCm39) T145N probably benign Het
Art1 A T 7: 101,756,052 (GRCm39) Q81L probably benign Het
Astl A T 2: 127,185,903 (GRCm39) S71C probably damaging Het
Atp2a1 A G 7: 126,047,977 (GRCm39) I611T probably damaging Het
Bltp1 T A 3: 36,997,363 (GRCm39) V1140E probably benign Het
Cacna2d2 T A 9: 107,404,632 (GRCm39) V1139D possibly damaging Het
Castor1 G T 11: 4,171,639 (GRCm39) A288S probably damaging Het
Chst10 T A 1: 38,905,112 (GRCm39) K198* probably null Het
Ckmt2 G A 13: 92,011,431 (GRCm39) H60Y possibly damaging Het
Coq7 G C 7: 118,132,469 (GRCm39) S2R possibly damaging Het
Cspp1 T A 1: 10,183,238 (GRCm39) D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,062,176 (GRCm39) probably null Het
Daam2 C A 17: 49,771,566 (GRCm39) G860V probably damaging Het
Ecm2 A T 13: 49,668,326 (GRCm39) I10F probably benign Het
Epb41l1 A T 2: 156,348,332 (GRCm39) D312V probably damaging Het
Epsti1 G A 14: 78,168,741 (GRCm39) R126H probably damaging Het
Erc1 A T 6: 119,750,626 (GRCm39) Y367* probably null Het
Erh T A 12: 80,684,352 (GRCm39) R42W probably damaging Het
Fam124a C T 14: 62,843,325 (GRCm39) Q278* probably null Het
Fbxo3 T A 2: 103,885,286 (GRCm39) L385Q probably damaging Het
Fbxo31 T A 8: 122,285,794 (GRCm39) T219S probably damaging Het
Fstl5 T G 3: 76,555,725 (GRCm39) V534G possibly damaging Het
Gbp2b A T 3: 142,323,925 (GRCm39) I577F probably benign Het
Gbp8 A T 5: 105,198,783 (GRCm39) L44* probably null Het
Gck C T 11: 5,860,301 (GRCm39) A114T probably benign Het
Gtf2i A G 5: 134,284,688 (GRCm39) V537A possibly damaging Het
Iqcm C A 8: 76,489,733 (GRCm39) H400Q probably damaging Het
Iqcn T C 8: 71,163,555 (GRCm39) V916A probably benign Het
Itpr1 T C 6: 108,363,589 (GRCm39) L737P probably damaging Het
Jakmip1 A G 5: 37,258,116 (GRCm39) E254G probably damaging Het
Kif15 A T 9: 122,836,490 (GRCm39) R1095W possibly damaging Het
Klhdc8a G A 1: 132,230,846 (GRCm39) R237Q probably benign Het
Klhl38 T C 15: 58,186,258 (GRCm39) E157G probably benign Het
Klrk1 T A 6: 129,589,786 (GRCm39) N221I probably benign Het
Lhx8 A T 3: 154,012,576 (GRCm39) H345Q probably damaging Het
Lims1 T A 10: 58,245,494 (GRCm39) N174K probably benign Het
Madd T A 2: 90,997,406 (GRCm39) Q754L probably benign Het
Mau2 T C 8: 70,472,440 (GRCm39) D581G probably damaging Het
Miga1 A T 3: 151,982,393 (GRCm39) I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mob3c T C 4: 115,688,884 (GRCm39) V139A probably benign Het
Nadk G T 4: 155,661,524 (GRCm39) D17Y probably benign Het
Nalf1 T C 8: 9,257,892 (GRCm39) T419A probably benign Het
Ncapd2 C T 6: 125,157,989 (GRCm39) V380I probably damaging Het
Nes G A 3: 87,884,315 (GRCm39) R858K probably benign Het
Nphp3 T C 9: 103,909,162 (GRCm39) S791P probably benign Het
Nup210 T C 6: 91,047,215 (GRCm39) T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4c100 C T 2: 88,356,215 (GRCm39) T96I probably benign Het
Or8b50 T A 9: 38,518,685 (GRCm39) M308K probably benign Het
Ovgp1 T A 3: 105,883,339 (GRCm39) S105T probably benign Het
Pbld2 T A 10: 62,883,771 (GRCm39) C79S probably damaging Het
Pik3cd T A 4: 149,744,323 (GRCm39) M143L possibly damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Poln A G 5: 34,280,016 (GRCm39) V282A probably benign Het
Ppp1r11 T C 17: 37,262,338 (GRCm39) T21A probably damaging Het
Prpf8 T A 11: 75,393,368 (GRCm39) I1664N possibly damaging Het
Prr29 C T 11: 106,267,738 (GRCm39) A161V probably benign Het
Rasa3 T C 8: 13,638,931 (GRCm39) D292G probably damaging Het
Rnf25 T C 1: 74,633,123 (GRCm39) T411A probably damaging Het
Rraga C T 4: 86,494,217 (GRCm39) T21I probably damaging Het
Setdb2 T A 14: 59,639,824 (GRCm39) Y673F probably damaging Het
Sf3a1 C T 11: 4,117,787 (GRCm39) T183I probably damaging Het
Shank3 A T 15: 89,389,642 (GRCm39) H413L probably damaging Het
Slc30a5 A G 13: 100,950,189 (GRCm39) probably null Het
Slc6a18 T C 13: 73,813,745 (GRCm39) S523G probably benign Het
Spaca1 C T 4: 34,044,207 (GRCm39) V96I probably damaging Het
Sycp2 C T 2: 178,016,378 (GRCm39) A695T probably benign Het
Tnrc18 C A 5: 142,717,807 (GRCm39) G2216C unknown Het
Trak2 T C 1: 58,985,447 (GRCm39) N17S probably benign Het
Ttn T A 2: 76,708,776 (GRCm39) N8792I unknown Het
Ttyh1 T C 7: 4,125,540 (GRCm39) V64A probably benign Het
Usb1 T A 8: 96,060,041 (GRCm39) S50R probably damaging Het
Ush2a T A 1: 188,689,570 (GRCm39) I5044N probably damaging Het
Vmn1r84 A T 7: 12,095,935 (GRCm39) F253I possibly damaging Het
Vmn2r99 T C 17: 19,600,302 (GRCm39) I442T probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Other mutations in Or6y1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Or6y1 APN 1 174,276,233 (GRCm39) missense probably benign 0.00
IGL03369:Or6y1 APN 1 174,276,435 (GRCm39) missense probably damaging 1.00
R1792:Or6y1 UTSW 1 174,276,303 (GRCm39) missense probably benign
R4090:Or6y1 UTSW 1 174,276,500 (GRCm39) missense probably benign 0.01
R4169:Or6y1 UTSW 1 174,277,162 (GRCm39) missense unknown
R4769:Or6y1 UTSW 1 174,276,524 (GRCm39) missense possibly damaging 0.80
R6652:Or6y1 UTSW 1 174,276,627 (GRCm39) missense probably damaging 1.00
R6930:Or6y1 UTSW 1 174,276,677 (GRCm39) missense probably damaging 1.00
R7237:Or6y1 UTSW 1 174,276,905 (GRCm39) missense probably benign 0.05
R8187:Or6y1 UTSW 1 174,276,838 (GRCm39) frame shift probably null
R8518:Or6y1 UTSW 1 174,276,742 (GRCm39) nonsense probably null
R9177:Or6y1 UTSW 1 174,276,923 (GRCm39) missense probably damaging 1.00
R9453:Or6y1 UTSW 1 174,276,233 (GRCm39) missense probably benign 0.00
R9757:Or6y1 UTSW 1 174,276,866 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCGTCCTAAGCTCATGTATG -3'
(R):5'- GGCCATCGACCTAAGTATACC -3'

Sequencing Primer
(F):5'- GCCTACAATTCAAACAAAGTGGTGTC -3'
(R):5'- CATGTGCTTCATGTTGCCAG -3'
Posted On 2020-01-23