Incidental Mutation 'R0661:Spx'
List |< first << previous [record 34 of 42] next >> last >|
ID61837
Institutional Source Beutler Lab
Gene Symbol Spx
Ensembl Gene ENSMUSG00000071112
Gene Namespexin hormone
SynonymsB230216G23Rik
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0661 (G1)
Quality Score149
Status Not validated
Chromosome6
Chromosomal Location142413441-142419730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142413839 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 5 (S5G)
Ref Sequence ENSEMBL: ENSMUSP00000118062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126521] [ENSMUST00000211094]
Predicted Effect probably benign
Transcript: ENSMUST00000088263
AA Change: S5G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085597
Gene: ENSMUSG00000071112
AA Change: S5G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Spexin 27 116 1.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123209
Predicted Effect possibly damaging
Transcript: ENSMUST00000126521
AA Change: S5G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118062
Gene: ENSMUSG00000071112
AA Change: S5G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Spexin 25 114 4.3e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141548
SMART Domains Protein: ENSMUSP00000118648
Gene: ENSMUSG00000071112

DomainStartEndE-ValueType
Pfam:Spexin 1 75 6.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211094
AA Change: S5G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a hormone involved in modulation of cardiovascular and renal function. It has also been shown in rats to cause weight loss. Several transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Spx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1448:Spx UTSW 6 142418513 missense probably benign 0.09
R1848:Spx UTSW 6 142414079 critical splice donor site probably null
R1992:Spx UTSW 6 142418519 missense probably benign 0.09
R3917:Spx UTSW 6 142414031 missense probably damaging 0.99
R4868:Spx UTSW 6 142416390 nonsense probably null
R5279:Spx UTSW 6 142414040 missense probably damaging 0.99
R7693:Spx UTSW 6 142414790 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTGACAAGCTACCCTCGTGGTC -3'
(R):5'- AGTTCCTCTTCTCAGAGAGTCGCTG -3'

Sequencing Primer
(F):5'- CTGGACATTTGAAGAATAGTGCC -3'
(R):5'- TGCAGTGCAGGGAGGAG -3'
Posted On2013-07-30