Incidental Mutation 'R8039:Madd'
ID618372
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene NameMAP-kinase activating death domain
SynonymsRab3 GEP, 9630059K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91137360-91183837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91167061 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 754 (Q754L)
Ref Sequence ENSEMBL: ENSMUSP00000107001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]
Predicted Effect probably benign
Transcript: ENSMUST00000066420
AA Change: Q754L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
AA Change: Q754L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
AA Change: Q735L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: Q735L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
AA Change: Q754L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
AA Change: Q754L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099725
AA Change: Q754L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111369
AA Change: Q754L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111370
AA Change: Q754L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
AA Change: Q735L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: Q735L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
AA Change: Q754L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111373
AA Change: Q754L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111375
AA Change: Q754L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111376
AA Change: Q754L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111381
AA Change: Q754L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140600
SMART Domains Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
Blast:DENN 1 28 7e-10 BLAST
low complexity region 39 55 N/A INTRINSIC
dDENN 111 165 9.37e-1 SMART
low complexity region 230 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91175766 unclassified probably benign
IGL00781:Madd APN 2 91146928 missense probably benign 0.00
IGL00844:Madd APN 2 91167868 missense probably damaging 1.00
IGL00942:Madd APN 2 91170578 missense probably damaging 1.00
IGL01100:Madd APN 2 91158040 missense probably damaging 1.00
IGL01116:Madd APN 2 91154543 splice site probably benign
IGL01694:Madd APN 2 91157975 splice site probably benign
IGL01982:Madd APN 2 91175707 missense probably damaging 1.00
IGL02346:Madd APN 2 91162491 missense probably damaging 0.97
IGL02354:Madd APN 2 91162198 missense probably benign 0.17
IGL02361:Madd APN 2 91162198 missense probably benign 0.17
IGL02481:Madd APN 2 91178036 missense probably damaging 1.00
IGL02483:Madd APN 2 91178036 missense probably damaging 1.00
IGL02948:Madd APN 2 91142827 missense probably benign
IGL03338:Madd APN 2 91162162 missense possibly damaging 0.48
BB005:Madd UTSW 2 91176888 missense probably damaging 1.00
BB015:Madd UTSW 2 91176888 missense probably damaging 1.00
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0027:Madd UTSW 2 91152549 missense probably damaging 0.97
R0085:Madd UTSW 2 91162738 missense probably benign 0.00
R0577:Madd UTSW 2 91138395 missense possibly damaging 0.88
R0587:Madd UTSW 2 91146885 missense probably damaging 1.00
R1112:Madd UTSW 2 91143599 missense probably damaging 1.00
R1722:Madd UTSW 2 91167637 missense probably benign
R1750:Madd UTSW 2 91167891 missense probably damaging 0.98
R2061:Madd UTSW 2 91161486 intron probably benign
R2112:Madd UTSW 2 91176976 missense possibly damaging 0.89
R2114:Madd UTSW 2 91164022 missense probably damaging 1.00
R2140:Madd UTSW 2 91152509 missense possibly damaging 0.80
R2276:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2277:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2279:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2424:Madd UTSW 2 91166622 missense probably damaging 1.00
R2904:Madd UTSW 2 91175672 missense probably damaging 1.00
R3122:Madd UTSW 2 91176209 missense probably damaging 1.00
R3836:Madd UTSW 2 91154643 critical splice donor site probably null
R3979:Madd UTSW 2 91176828 missense possibly damaging 0.81
R4151:Madd UTSW 2 91143083 missense probably benign 0.11
R4233:Madd UTSW 2 91178236 missense probably benign 0.26
R4236:Madd UTSW 2 91167028 missense probably benign 0.00
R4299:Madd UTSW 2 91169803 missense probably damaging 1.00
R4334:Madd UTSW 2 91140572 missense probably benign 0.08
R4413:Madd UTSW 2 91167587 missense probably damaging 1.00
R4595:Madd UTSW 2 91167664 missense possibly damaging 0.80
R4694:Madd UTSW 2 91160328 missense probably damaging 0.99
R5410:Madd UTSW 2 91154514 missense probably damaging 1.00
R5490:Madd UTSW 2 91170635 missense possibly damaging 0.80
R5560:Madd UTSW 2 91163545 missense probably damaging 1.00
R5661:Madd UTSW 2 91154433 critical splice donor site probably null
R5710:Madd UTSW 2 91154476 missense probably damaging 1.00
R5730:Madd UTSW 2 91158109 missense probably damaging 1.00
R5759:Madd UTSW 2 91162075 missense possibly damaging 0.94
R5768:Madd UTSW 2 91167829 missense probably damaging 1.00
R5822:Madd UTSW 2 91152533 missense probably damaging 1.00
R6125:Madd UTSW 2 91152452 critical splice donor site probably null
R6151:Madd UTSW 2 91165457 nonsense probably null
R6229:Madd UTSW 2 91143670 missense probably damaging 0.96
R6230:Madd UTSW 2 91143521 critical splice donor site probably null
R6245:Madd UTSW 2 91178104 missense probably benign 0.27
R6323:Madd UTSW 2 91161438 splice site probably null
R6456:Madd UTSW 2 91178191 missense probably benign
R6473:Madd UTSW 2 91167059 missense probably benign
R6878:Madd UTSW 2 91169857 missense probably damaging 1.00
R7060:Madd UTSW 2 91177107 missense probably damaging 1.00
R7065:Madd UTSW 2 91155057 missense probably benign 0.26
R7073:Madd UTSW 2 91162509 missense probably damaging 1.00
R7124:Madd UTSW 2 91162048 missense possibly damaging 0.94
R7251:Madd UTSW 2 91162176 missense probably benign 0.01
R7510:Madd UTSW 2 91177976 missense possibly damaging 0.80
R7605:Madd UTSW 2 91169710 missense possibly damaging 0.90
R7911:Madd UTSW 2 91167508 missense probably null 0.01
R7928:Madd UTSW 2 91176888 missense probably damaging 1.00
R7952:Madd UTSW 2 91162541 missense probably damaging 1.00
R8047:Madd UTSW 2 91179201 missense probably damaging 1.00
R8048:Madd UTSW 2 91154448 missense probably damaging 0.99
R8070:Madd UTSW 2 91158014 nonsense probably null
R8090:Madd UTSW 2 91155623 missense probably benign 0.01
R8335:Madd UTSW 2 91170239 missense probably damaging 1.00
R8459:Madd UTSW 2 91162526 missense probably benign
X0067:Madd UTSW 2 91152473 missense probably damaging 1.00
Z1176:Madd UTSW 2 91159272 missense probably damaging 0.96
Z1177:Madd UTSW 2 91142831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTAACCTTGCCCAGGGTC -3'
(R):5'- GCTCCACTGAACTGAAACTATG -3'

Sequencing Primer
(F):5'- CTTAGTCGCCCATCTAAAAAGGATG -3'
(R):5'- ACTATGGGTAAGTCTCCACTGGAC -3'
Posted On2020-01-23