Incidental Mutation 'R8039:Madd'
ID 618372
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene Name MAP-kinase activating death domain
Synonyms Rab3 GEP, 9630059K23Rik
MMRRC Submission 067476-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 90967705-91013404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90997406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 754 (Q754L)
Ref Sequence ENSEMBL: ENSMUSP00000107001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111370] [ENSMUST00000111369] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066420
AA Change: Q754L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
AA Change: Q754L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
AA Change: Q735L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: Q735L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
AA Change: Q754L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
AA Change: Q754L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099725
AA Change: Q754L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111370
AA Change: Q754L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111369
AA Change: Q754L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
AA Change: Q735L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: Q735L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
AA Change: Q754L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111373
AA Change: Q754L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111375
AA Change: Q754L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111376
AA Change: Q754L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111381
AA Change: Q754L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: Q754L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140600
SMART Domains Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
Blast:DENN 1 28 7e-10 BLAST
low complexity region 39 55 N/A INTRINSIC
dDENN 111 165 9.37e-1 SMART
low complexity region 230 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,699 (GRCm39) H225R probably damaging Het
Adgrb2 T A 4: 129,916,061 (GRCm39) L1451Q probably damaging Het
Afdn T C 17: 14,119,403 (GRCm39) L1713P probably damaging Het
Agr2 A T 12: 36,045,558 (GRCm39) I15F probably benign Het
Agrn T C 4: 156,253,468 (GRCm39) T1808A probably benign Het
Akap6 A G 12: 53,188,459 (GRCm39) I1958V probably benign Het
Ankrd60 C A 2: 173,414,284 (GRCm39) probably null Het
Anpep A G 7: 79,489,148 (GRCm39) probably null Het
Apoa4 A T 9: 46,153,591 (GRCm39) D64V possibly damaging Het
Arhgef26 C A 3: 62,247,351 (GRCm39) T145N probably benign Het
Art1 A T 7: 101,756,052 (GRCm39) Q81L probably benign Het
Astl A T 2: 127,185,903 (GRCm39) S71C probably damaging Het
Atp2a1 A G 7: 126,047,977 (GRCm39) I611T probably damaging Het
Bltp1 T A 3: 36,997,363 (GRCm39) V1140E probably benign Het
Cacna2d2 T A 9: 107,404,632 (GRCm39) V1139D possibly damaging Het
Castor1 G T 11: 4,171,639 (GRCm39) A288S probably damaging Het
Chst10 T A 1: 38,905,112 (GRCm39) K198* probably null Het
Ckmt2 G A 13: 92,011,431 (GRCm39) H60Y possibly damaging Het
Coq7 G C 7: 118,132,469 (GRCm39) S2R possibly damaging Het
Cspp1 T A 1: 10,183,238 (GRCm39) D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,062,176 (GRCm39) probably null Het
Daam2 C A 17: 49,771,566 (GRCm39) G860V probably damaging Het
Ecm2 A T 13: 49,668,326 (GRCm39) I10F probably benign Het
Epb41l1 A T 2: 156,348,332 (GRCm39) D312V probably damaging Het
Epsti1 G A 14: 78,168,741 (GRCm39) R126H probably damaging Het
Erc1 A T 6: 119,750,626 (GRCm39) Y367* probably null Het
Erh T A 12: 80,684,352 (GRCm39) R42W probably damaging Het
Fam124a C T 14: 62,843,325 (GRCm39) Q278* probably null Het
Fbxo3 T A 2: 103,885,286 (GRCm39) L385Q probably damaging Het
Fbxo31 T A 8: 122,285,794 (GRCm39) T219S probably damaging Het
Fstl5 T G 3: 76,555,725 (GRCm39) V534G possibly damaging Het
Gbp2b A T 3: 142,323,925 (GRCm39) I577F probably benign Het
Gbp8 A T 5: 105,198,783 (GRCm39) L44* probably null Het
Gck C T 11: 5,860,301 (GRCm39) A114T probably benign Het
Gtf2i A G 5: 134,284,688 (GRCm39) V537A possibly damaging Het
Iqcm C A 8: 76,489,733 (GRCm39) H400Q probably damaging Het
Iqcn T C 8: 71,163,555 (GRCm39) V916A probably benign Het
Itpr1 T C 6: 108,363,589 (GRCm39) L737P probably damaging Het
Jakmip1 A G 5: 37,258,116 (GRCm39) E254G probably damaging Het
Kif15 A T 9: 122,836,490 (GRCm39) R1095W possibly damaging Het
Klhdc8a G A 1: 132,230,846 (GRCm39) R237Q probably benign Het
Klhl38 T C 15: 58,186,258 (GRCm39) E157G probably benign Het
Klrk1 T A 6: 129,589,786 (GRCm39) N221I probably benign Het
Lhx8 A T 3: 154,012,576 (GRCm39) H345Q probably damaging Het
Lims1 T A 10: 58,245,494 (GRCm39) N174K probably benign Het
Mau2 T C 8: 70,472,440 (GRCm39) D581G probably damaging Het
Miga1 A T 3: 151,982,393 (GRCm39) I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mob3c T C 4: 115,688,884 (GRCm39) V139A probably benign Het
Nadk G T 4: 155,661,524 (GRCm39) D17Y probably benign Het
Nalf1 T C 8: 9,257,892 (GRCm39) T419A probably benign Het
Ncapd2 C T 6: 125,157,989 (GRCm39) V380I probably damaging Het
Nes G A 3: 87,884,315 (GRCm39) R858K probably benign Het
Nphp3 T C 9: 103,909,162 (GRCm39) S791P probably benign Het
Nup210 T C 6: 91,047,215 (GRCm39) T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4c100 C T 2: 88,356,215 (GRCm39) T96I probably benign Het
Or6y1 T A 1: 174,277,162 (GRCm39) S324R unknown Het
Or8b50 T A 9: 38,518,685 (GRCm39) M308K probably benign Het
Ovgp1 T A 3: 105,883,339 (GRCm39) S105T probably benign Het
Pbld2 T A 10: 62,883,771 (GRCm39) C79S probably damaging Het
Pik3cd T A 4: 149,744,323 (GRCm39) M143L possibly damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Poln A G 5: 34,280,016 (GRCm39) V282A probably benign Het
Ppp1r11 T C 17: 37,262,338 (GRCm39) T21A probably damaging Het
Prpf8 T A 11: 75,393,368 (GRCm39) I1664N possibly damaging Het
Prr29 C T 11: 106,267,738 (GRCm39) A161V probably benign Het
Rasa3 T C 8: 13,638,931 (GRCm39) D292G probably damaging Het
Rnf25 T C 1: 74,633,123 (GRCm39) T411A probably damaging Het
Rraga C T 4: 86,494,217 (GRCm39) T21I probably damaging Het
Setdb2 T A 14: 59,639,824 (GRCm39) Y673F probably damaging Het
Sf3a1 C T 11: 4,117,787 (GRCm39) T183I probably damaging Het
Shank3 A T 15: 89,389,642 (GRCm39) H413L probably damaging Het
Slc30a5 A G 13: 100,950,189 (GRCm39) probably null Het
Slc6a18 T C 13: 73,813,745 (GRCm39) S523G probably benign Het
Spaca1 C T 4: 34,044,207 (GRCm39) V96I probably damaging Het
Sycp2 C T 2: 178,016,378 (GRCm39) A695T probably benign Het
Tnrc18 C A 5: 142,717,807 (GRCm39) G2216C unknown Het
Trak2 T C 1: 58,985,447 (GRCm39) N17S probably benign Het
Ttn T A 2: 76,708,776 (GRCm39) N8792I unknown Het
Ttyh1 T C 7: 4,125,540 (GRCm39) V64A probably benign Het
Usb1 T A 8: 96,060,041 (GRCm39) S50R probably damaging Het
Ush2a T A 1: 188,689,570 (GRCm39) I5044N probably damaging Het
Vmn1r84 A T 7: 12,095,935 (GRCm39) F253I possibly damaging Het
Vmn2r99 T C 17: 19,600,302 (GRCm39) I442T probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91,006,111 (GRCm39) unclassified probably benign
IGL00781:Madd APN 2 90,977,273 (GRCm39) missense probably benign 0.00
IGL00844:Madd APN 2 90,998,213 (GRCm39) missense probably damaging 1.00
IGL00942:Madd APN 2 91,000,923 (GRCm39) missense probably damaging 1.00
IGL01100:Madd APN 2 90,988,385 (GRCm39) missense probably damaging 1.00
IGL01116:Madd APN 2 90,984,888 (GRCm39) splice site probably benign
IGL01694:Madd APN 2 90,988,320 (GRCm39) splice site probably benign
IGL01982:Madd APN 2 91,006,052 (GRCm39) missense probably damaging 1.00
IGL02346:Madd APN 2 90,992,836 (GRCm39) missense probably damaging 0.97
IGL02354:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02361:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02481:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02483:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02948:Madd APN 2 90,973,172 (GRCm39) missense probably benign
IGL03338:Madd APN 2 90,992,507 (GRCm39) missense possibly damaging 0.48
BB005:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
BB015:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0027:Madd UTSW 2 90,982,894 (GRCm39) missense probably damaging 0.97
R0085:Madd UTSW 2 90,993,083 (GRCm39) missense probably benign 0.00
R0577:Madd UTSW 2 90,968,740 (GRCm39) missense possibly damaging 0.88
R0587:Madd UTSW 2 90,977,230 (GRCm39) missense probably damaging 1.00
R1112:Madd UTSW 2 90,973,944 (GRCm39) missense probably damaging 1.00
R1722:Madd UTSW 2 90,997,982 (GRCm39) missense probably benign
R1750:Madd UTSW 2 90,998,236 (GRCm39) missense probably damaging 0.98
R2061:Madd UTSW 2 90,991,831 (GRCm39) intron probably benign
R2112:Madd UTSW 2 91,007,321 (GRCm39) missense possibly damaging 0.89
R2114:Madd UTSW 2 90,994,367 (GRCm39) missense probably damaging 1.00
R2140:Madd UTSW 2 90,982,854 (GRCm39) missense possibly damaging 0.80
R2276:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2277:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2279:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2424:Madd UTSW 2 90,996,967 (GRCm39) missense probably damaging 1.00
R2904:Madd UTSW 2 91,006,017 (GRCm39) missense probably damaging 1.00
R3122:Madd UTSW 2 91,006,554 (GRCm39) missense probably damaging 1.00
R3836:Madd UTSW 2 90,984,988 (GRCm39) critical splice donor site probably null
R3979:Madd UTSW 2 91,007,173 (GRCm39) missense possibly damaging 0.81
R4151:Madd UTSW 2 90,973,428 (GRCm39) missense probably benign 0.11
R4233:Madd UTSW 2 91,008,581 (GRCm39) missense probably benign 0.26
R4236:Madd UTSW 2 90,997,373 (GRCm39) missense probably benign 0.00
R4299:Madd UTSW 2 91,000,148 (GRCm39) missense probably damaging 1.00
R4334:Madd UTSW 2 90,970,917 (GRCm39) missense probably benign 0.08
R4413:Madd UTSW 2 90,997,932 (GRCm39) missense probably damaging 1.00
R4595:Madd UTSW 2 90,998,009 (GRCm39) missense possibly damaging 0.80
R4694:Madd UTSW 2 90,990,673 (GRCm39) missense probably damaging 0.99
R5410:Madd UTSW 2 90,984,859 (GRCm39) missense probably damaging 1.00
R5490:Madd UTSW 2 91,000,980 (GRCm39) missense possibly damaging 0.80
R5560:Madd UTSW 2 90,993,890 (GRCm39) missense probably damaging 1.00
R5661:Madd UTSW 2 90,984,778 (GRCm39) critical splice donor site probably null
R5710:Madd UTSW 2 90,984,821 (GRCm39) missense probably damaging 1.00
R5730:Madd UTSW 2 90,988,454 (GRCm39) missense probably damaging 1.00
R5759:Madd UTSW 2 90,992,420 (GRCm39) missense possibly damaging 0.94
R5768:Madd UTSW 2 90,998,174 (GRCm39) missense probably damaging 1.00
R5822:Madd UTSW 2 90,982,878 (GRCm39) missense probably damaging 1.00
R6125:Madd UTSW 2 90,982,797 (GRCm39) critical splice donor site probably null
R6151:Madd UTSW 2 90,995,802 (GRCm39) nonsense probably null
R6229:Madd UTSW 2 90,974,015 (GRCm39) missense probably damaging 0.96
R6230:Madd UTSW 2 90,973,866 (GRCm39) critical splice donor site probably null
R6245:Madd UTSW 2 91,008,449 (GRCm39) missense probably benign 0.27
R6323:Madd UTSW 2 90,991,783 (GRCm39) splice site probably null
R6456:Madd UTSW 2 91,008,536 (GRCm39) missense probably benign
R6473:Madd UTSW 2 90,997,404 (GRCm39) missense probably benign
R6878:Madd UTSW 2 91,000,202 (GRCm39) missense probably damaging 1.00
R7060:Madd UTSW 2 91,007,452 (GRCm39) missense probably damaging 1.00
R7065:Madd UTSW 2 90,985,402 (GRCm39) missense probably benign 0.26
R7073:Madd UTSW 2 90,992,854 (GRCm39) missense probably damaging 1.00
R7124:Madd UTSW 2 90,992,393 (GRCm39) missense possibly damaging 0.94
R7251:Madd UTSW 2 90,992,521 (GRCm39) missense probably benign 0.01
R7510:Madd UTSW 2 91,008,321 (GRCm39) missense possibly damaging 0.80
R7605:Madd UTSW 2 91,000,055 (GRCm39) missense possibly damaging 0.90
R7911:Madd UTSW 2 90,997,853 (GRCm39) missense probably null 0.01
R7928:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R7952:Madd UTSW 2 90,992,886 (GRCm39) missense probably damaging 1.00
R8047:Madd UTSW 2 91,009,546 (GRCm39) missense probably damaging 1.00
R8048:Madd UTSW 2 90,984,793 (GRCm39) missense probably damaging 0.99
R8070:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R8090:Madd UTSW 2 90,985,968 (GRCm39) missense probably benign 0.01
R8335:Madd UTSW 2 91,000,584 (GRCm39) missense probably damaging 1.00
R8459:Madd UTSW 2 90,992,871 (GRCm39) missense probably benign
R8678:Madd UTSW 2 91,006,610 (GRCm39) missense probably damaging 1.00
R8920:Madd UTSW 2 91,007,168 (GRCm39) missense probably benign 0.04
R9003:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R9102:Madd UTSW 2 90,988,404 (GRCm39) missense probably benign 0.00
R9154:Madd UTSW 2 90,998,162 (GRCm39) missense probably damaging 1.00
R9242:Madd UTSW 2 90,973,949 (GRCm39) missense probably damaging 0.99
R9277:Madd UTSW 2 91,006,055 (GRCm39) missense probably damaging 1.00
R9394:Madd UTSW 2 91,000,199 (GRCm39) missense probably benign
R9490:Madd UTSW 2 91,008,501 (GRCm39) missense probably benign
R9499:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9551:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9553:Madd UTSW 2 91,008,800 (GRCm39) missense probably damaging 1.00
R9599:Madd UTSW 2 91,006,026 (GRCm39) missense probably damaging 1.00
R9695:Madd UTSW 2 90,992,929 (GRCm39) missense probably benign 0.17
R9729:Madd UTSW 2 91,000,544 (GRCm39) missense possibly damaging 0.60
X0067:Madd UTSW 2 90,982,818 (GRCm39) missense probably damaging 1.00
Z1176:Madd UTSW 2 90,989,617 (GRCm39) missense probably damaging 0.96
Z1177:Madd UTSW 2 90,973,176 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTAACCTTGCCCAGGGTC -3'
(R):5'- GCTCCACTGAACTGAAACTATG -3'

Sequencing Primer
(F):5'- CTTAGTCGCCCATCTAAAAAGGATG -3'
(R):5'- ACTATGGGTAAGTCTCCACTGGAC -3'
Posted On 2020-01-23