Incidental Mutation 'R0661:Sec11a'
ID61838
Institutional Source Beutler Lab
Gene Symbol Sec11a
Ensembl Gene ENSMUSG00000025724
Gene NameSEC11 homolog A, signal peptidase complex subunit
SynonymsSec11l1, 18kDa, sid2895, 1810012E07Rik, Spc18
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R0661 (G1)
Quality Score131
Status Not validated
Chromosome7
Chromosomal Location80904889-80947780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80935039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000112944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026818] [ENSMUST00000117383] [ENSMUST00000119980] [ENSMUST00000120285]
Predicted Effect probably benign
Transcript: ENSMUST00000026818
AA Change: V50A

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026818
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 6.2e-13 PFAM
low complexity region 166 176 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117383
AA Change: V50A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113601
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 112 3.1e-12 PFAM
low complexity region 177 187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119980
AA Change: V50A

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112425
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 2.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120285
AA Change: V50A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112944
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 123 8.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147881
Meta Mutation Damage Score 0.5930 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S26B family. The encoded protein is an 18kDa subunit of the signal peptidase complex and has been linked to cell migration and invasion, gastric cancer and lymph node metastasis. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Sec11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Sec11a APN 7 80935062 missense probably benign 0.21
R0083:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R0108:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R1511:Sec11a UTSW 7 80927734 splice site probably null
R1704:Sec11a UTSW 7 80935100 missense possibly damaging 0.47
R4209:Sec11a UTSW 7 80935042 missense probably damaging 1.00
R5135:Sec11a UTSW 7 80923064 intron probably benign
R6362:Sec11a UTSW 7 80923131 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCCTGATATACCAAACACAGGAATGC -3'
(R):5'- TCATTTCCTTCCCTGGGTGAGGATAG -3'

Sequencing Primer
(F):5'- acacacaaacacactgacac -3'
(R):5'- ATAGTGGTGGATCTGATTTCTTCTC -3'
Posted On2013-07-30