Incidental Mutation 'R0661:Tm6sf1'
ID61839
Institutional Source Beutler Lab
Gene Symbol Tm6sf1
Ensembl Gene ENSMUSG00000038623
Gene Nametransmembrane 6 superfamily member 1
SynonymsC630016D09Rik
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0661 (G1)
Quality Score86
Status Not validated
Chromosome7
Chromosomal Location81859001-81884434 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 81865345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041890] [ENSMUST00000119543] [ENSMUST00000119543] [ENSMUST00000126334]
Predicted Effect probably null
Transcript: ENSMUST00000041890
SMART Domains Protein: ENSMUSP00000038017
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
Pfam:DUF2781 217 356 6.9e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119543
SMART Domains Protein: ENSMUSP00000112400
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Pfam:DUF2781 126 267 9.7e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119543
SMART Domains Protein: ENSMUSP00000112400
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Pfam:DUF2781 126 267 9.7e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124616
Predicted Effect probably benign
Transcript: ENSMUST00000126334
SMART Domains Protein: ENSMUSP00000121292
Gene: ENSMUSG00000038623

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207657
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Tm6sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Tm6sf1 APN 7 81875803 missense probably damaging 1.00
IGL02145:Tm6sf1 APN 7 81863252 nonsense probably null
IGL02472:Tm6sf1 APN 7 81875824 splice site probably benign
IGL02862:Tm6sf1 APN 7 81870756 missense probably damaging 0.98
R0083:Tm6sf1 UTSW 7 81865345 critical splice donor site probably null
R0108:Tm6sf1 UTSW 7 81865345 critical splice donor site probably null
R3019:Tm6sf1 UTSW 7 81876065 missense probably benign 0.01
R4562:Tm6sf1 UTSW 7 81859461 missense probably damaging 1.00
R4825:Tm6sf1 UTSW 7 81865260 missense probably damaging 0.97
R4851:Tm6sf1 UTSW 7 81865343 missense probably null 1.00
R5285:Tm6sf1 UTSW 7 81859452 missense possibly damaging 0.94
R6454:Tm6sf1 UTSW 7 81876053 missense probably damaging 1.00
R7624:Tm6sf1 UTSW 7 81868710 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGTGTAGATGACGCCCACAGAATC -3'
(R):5'- TGGTTGGTAGGGACTTCCAAAAGC -3'

Sequencing Primer
(F):5'- CAGAATCTTCTGGGACACCTAGTG -3'
(R):5'- gcttcccaaatgctgagattac -3'
Posted On2013-07-30