Incidental Mutation 'R8039:Pik3cd'
ID618391
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms2410099E07Rik, p110delta, 2610208K16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149649168-149702571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149659866 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 143 (M143L)
Ref Sequence ENSEMBL: ENSMUSP00000101315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000127273] [ENSMUST00000131224] [ENSMUST00000134534] [ENSMUST00000146612] [ENSMUST00000156309] [ENSMUST00000177654]
Predicted Effect probably benign
Transcript: ENSMUST00000038859
AA Change: M143L

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105688
AA Change: M143L

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105689
AA Change: M143L

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105690
AA Change: M143L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118704
AA Change: M143L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122059
AA Change: M143L

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127273
AA Change: M143L

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119858
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Blast:PI3K_rbd 126 171 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000131224
AA Change: M143L

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115542
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134534
SMART Domains Protein: ENSMUSP00000118988
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
Pfam:PI3K_p85B 31 62 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146612
SMART Domains Protein: ENSMUSP00000121843
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156309
Predicted Effect possibly damaging
Transcript: ENSMUST00000177654
AA Change: M143L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: M143L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149654571 missense probably benign
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
stinger UTSW 4 149657319 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1246:Pik3cd UTSW 4 149659800 missense probably damaging 1.00
R1259:Pik3cd UTSW 4 149650648 nonsense probably null
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.02
R1796:Pik3cd UTSW 4 149654119 missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149663203 missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
R6282:Pik3cd UTSW 4 149659743 missense probably benign 0.00
R6453:Pik3cd UTSW 4 149652302 missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149659714 missense probably benign 0.08
R7423:Pik3cd UTSW 4 149651763 critical splice donor site probably null
R7508:Pik3cd UTSW 4 149654583 missense possibly damaging 0.78
R7665:Pik3cd UTSW 4 149654050 missense possibly damaging 0.70
R7897:Pik3cd UTSW 4 149657269 missense probably benign 0.06
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149654847 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCCTCATATGCTACTGGG -3'
(R):5'- CGTGAAGAAGCTCATTAACTCCC -3'

Sequencing Primer
(F):5'- CCCTCATATGCTACTGGGAGAAG -3'
(R):5'- CAGATCAGCCTCCTCATTGG -3'
Posted On2020-01-23