Incidental Mutation 'R8039:Gtf2i'
ID618397
Institutional Source Beutler Lab
Gene Symbol Gtf2i
Ensembl Gene ENSMUSG00000060261
Gene Namegeneral transcription factor II I
SynonymsBAP-135, 6030441I21Rik, TFII-I
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134237834-134314760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134255834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 537 (V537A)
Ref Sequence ENSEMBL: ENSMUSP00000049625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059042] [ENSMUST00000082057] [ENSMUST00000111261] [ENSMUST00000172715] [ENSMUST00000173341] [ENSMUST00000173888] [ENSMUST00000174155] [ENSMUST00000174354] [ENSMUST00000174513] [ENSMUST00000174772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059042
AA Change: V537A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049625
Gene: ENSMUSG00000060261
AA Change: V537A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.4e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 436 3.4e-33 PFAM
Pfam:GTF2I 466 541 5e-34 PFAM
Pfam:GTF2I 571 646 3.3e-33 PFAM
Pfam:GTF2I 733 808 3.9e-33 PFAM
Pfam:GTF2I 868 943 9.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082057
AA Change: V516A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080714
Gene: ENSMUSG00000060261
AA Change: V516A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111261
AA Change: V518A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106892
Gene: ENSMUSG00000060261
AA Change: V518A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172715
AA Change: V452A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134035
Gene: ENSMUSG00000060261
AA Change: V452A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 9.7e-35 PFAM
low complexity region 243 253 N/A INTRINSIC
Pfam:GTF2I 276 351 2.4e-33 PFAM
Pfam:GTF2I 381 456 3.6e-34 PFAM
Pfam:GTF2I 486 561 2.4e-33 PFAM
Pfam:GTF2I 648 723 2.8e-33 PFAM
Pfam:GTF2I 783 858 6.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173341
AA Change: V497A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133444
Gene: ENSMUSG00000060261
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 2.6e-33 PFAM
Pfam:GTF2I 426 501 3.8e-34 PFAM
Pfam:GTF2I 531 606 2.5e-33 PFAM
Pfam:GTF2I 693 768 3e-33 PFAM
Pfam:GTF2I 832 907 7.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173888
AA Change: V478A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133969
Gene: ENSMUSG00000060261
AA Change: V478A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
Pfam:GTF2I 302 377 3.2e-33 PFAM
Pfam:GTF2I 407 482 4.6e-34 PFAM
Pfam:GTF2I 512 587 3.1e-33 PFAM
Pfam:GTF2I 674 749 3.6e-33 PFAM
Pfam:GTF2I 809 884 8.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174133
SMART Domains Protein: ENSMUSP00000134111
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Pfam:GTF2I 96 170 2.7e-32 PFAM
low complexity region 209 225 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Pfam:GTF2I 279 353 5.1e-31 PFAM
Pfam:GTF2I 384 437 2.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174155
AA Change: V537A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133566
Gene: ENSMUSG00000060261
AA Change: V537A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 186 1.6e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 435 3e-33 PFAM
Pfam:GTF2I 466 540 9.1e-34 PFAM
Pfam:GTF2I 571 645 1.8e-32 PFAM
Pfam:GTF2I 733 807 2.2e-33 PFAM
Pfam:GTF2I 868 942 6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174354
AA Change: V518A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134440
Gene: ENSMUSG00000060261
AA Change: V518A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174513
AA Change: V497A

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133489
Gene: ENSMUSG00000060261
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 3.2e-33 PFAM
Pfam:GTF2I 426 501 4.8e-34 PFAM
Pfam:GTF2I 531 606 3.2e-33 PFAM
Pfam:GTF2I 693 768 3.7e-33 PFAM
Pfam:GTF2I 828 903 8.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174772
AA Change: V516A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133740
Gene: ENSMUSG00000060261
AA Change: V516A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein containing six characteristic repeat motifs. The encoded protein binds to the initiator element (Inr) and E-box element in promoters and functions as a regulator of transcription. This locus, along with several other neighboring genes, is deleted in Williams-Beuren syndrome. There are many closely related genes and pseudogenes for this gene on chromosome 7. This gene also has pseudogenes on chromosomes 9, 13, and 21. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for null allele is embryonic lethal, and show brain hemorrhage and neural tube defects. Although most heterozygote are normal and fertile, at low frequency, growth retardation and small head are also reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Gtf2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Gtf2i APN 5 134242748 missense probably damaging 1.00
IGL01565:Gtf2i APN 5 134255913 missense probably damaging 0.97
IGL01743:Gtf2i APN 5 134286893 missense probably damaging 1.00
IGL01809:Gtf2i APN 5 134249950 missense probably damaging 1.00
IGL02553:Gtf2i APN 5 134245161 missense probably damaging 1.00
IGL02814:Gtf2i APN 5 134286704 missense probably damaging 1.00
IGL02869:Gtf2i APN 5 134279427 splice site probably benign
IGL03018:Gtf2i APN 5 134289335 missense possibly damaging 0.79
IGL03051:Gtf2i APN 5 134242914 nonsense probably null
P0041:Gtf2i UTSW 5 134244888 splice site probably benign
R0330:Gtf2i UTSW 5 134251886 missense probably damaging 0.98
R0515:Gtf2i UTSW 5 134242919 missense probably damaging 1.00
R0529:Gtf2i UTSW 5 134261869 nonsense probably null
R0594:Gtf2i UTSW 5 134242173 splice site probably benign
R0650:Gtf2i UTSW 5 134261837 splice site probably benign
R1055:Gtf2i UTSW 5 134263624 missense probably damaging 1.00
R1079:Gtf2i UTSW 5 134242894 splice site probably benign
R1916:Gtf2i UTSW 5 134246848 missense probably damaging 1.00
R2969:Gtf2i UTSW 5 134251892 missense probably damaging 0.98
R3013:Gtf2i UTSW 5 134295504 splice site probably benign
R4392:Gtf2i UTSW 5 134260629 missense probably damaging 0.96
R4421:Gtf2i UTSW 5 134255037 missense possibly damaging 0.86
R4635:Gtf2i UTSW 5 134245174 missense probably damaging 1.00
R4763:Gtf2i UTSW 5 134255964 missense probably damaging 1.00
R4770:Gtf2i UTSW 5 134243560 missense possibly damaging 0.53
R5063:Gtf2i UTSW 5 134260571 missense probably damaging 1.00
R5195:Gtf2i UTSW 5 134244832 nonsense probably null
R5829:Gtf2i UTSW 5 134263693 missense probably damaging 1.00
R6005:Gtf2i UTSW 5 134255958 nonsense probably null
R6119:Gtf2i UTSW 5 134287057 splice site probably null
R6576:Gtf2i UTSW 5 134263702 missense probably damaging 1.00
R6936:Gtf2i UTSW 5 134242785 missense probably damaging 1.00
R7070:Gtf2i UTSW 5 134282803 missense probably damaging 1.00
R7071:Gtf2i UTSW 5 134263621 missense probably damaging 1.00
R7142:Gtf2i UTSW 5 134244851 missense possibly damaging 0.95
R7366:Gtf2i UTSW 5 134265749 missense probably damaging 1.00
R7694:Gtf2i UTSW 5 134282805 missense probably damaging 1.00
R7879:Gtf2i UTSW 5 134266617 missense possibly damaging 0.77
R8041:Gtf2i UTSW 5 134293745 critical splice donor site probably null
R8154:Gtf2i UTSW 5 134251867 missense probably benign 0.07
R8365:Gtf2i UTSW 5 134274580 missense probably benign 0.22
X0022:Gtf2i UTSW 5 134263616 missense probably damaging 1.00
Z1176:Gtf2i UTSW 5 134263645 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTTAGGCTCACAAGACAG -3'
(R):5'- TGCTCATTTCCACAGCCGAG -3'

Sequencing Primer
(F):5'- CTCACAAGACAGAGCTGTTCTTGAG -3'
(R):5'- TTCCACAGCCGAGGCCTTG -3'
Posted On2020-01-23