Incidental Mutation 'R8039:Nup210'
ID618399
Institutional Source Beutler Lab
Gene Symbol Nup210
Ensembl Gene ENSMUSG00000030091
Gene Namenucleoporin 210
Synonymsgp190, Pom210, gp210
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91013068-91116829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91070233 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 496 (T496A)
Ref Sequence ENSEMBL: ENSMUSP00000032179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509]
Predicted Effect probably benign
Transcript: ENSMUST00000032179
AA Change: T496A

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: T496A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 3e-29 BLAST
low complexity region 850 862 N/A INTRINSIC
Blast:S1 937 1022 6e-37 BLAST
BID_2 1077 1152 8.36e-6 SMART
low complexity region 1159 1168 N/A INTRINSIC
Blast:BID_2 1468 1551 3e-35 BLAST
transmembrane domain 1809 1831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113509
AA Change: T496A

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: T496A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 4e-29 BLAST
low complexity region 806 818 N/A INTRINSIC
Blast:S1 893 978 4e-37 BLAST
BID_2 1033 1108 8.36e-6 SMART
low complexity region 1115 1124 N/A INTRINSIC
Blast:BID_2 1424 1507 3e-35 BLAST
transmembrane domain 1765 1787 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Nup210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nup210 APN 6 91030097 missense possibly damaging 0.92
IGL01532:Nup210 APN 6 91085999 splice site probably benign
IGL01574:Nup210 APN 6 91040564 missense probably benign 0.35
IGL01621:Nup210 APN 6 91030117 missense probably damaging 1.00
IGL01976:Nup210 APN 6 91053614 missense possibly damaging 0.89
IGL02089:Nup210 APN 6 91076698 missense probably benign 0.04
IGL02291:Nup210 APN 6 91101268 missense probably damaging 1.00
IGL03013:Nup210 APN 6 91053379 missense probably benign 0.00
IGL03046:Nup210 APN 6 91018996 splice site probably benign
IGL03136:Nup210 APN 6 91028861 missense probably benign 0.32
IGL03139:Nup210 APN 6 91020239 missense probably benign 0.08
IGL03195:Nup210 APN 6 91015850 missense probably benign 0.32
IGL03344:Nup210 APN 6 91021429 missense possibly damaging 0.53
brotherhood UTSW 6 91036469 missense possibly damaging 0.81
equality UTSW 6 91021395 critical splice donor site probably null
Liberty UTSW 6 91020180 missense probably benign 0.04
unity UTSW 6 91031668 nonsense probably null
IGL03134:Nup210 UTSW 6 91030190 missense probably damaging 0.99
PIT4810001:Nup210 UTSW 6 91030124 missense probably damaging 1.00
R0100:Nup210 UTSW 6 91069193 missense probably benign 0.04
R0348:Nup210 UTSW 6 91074310 missense probably benign 0.27
R0385:Nup210 UTSW 6 91028795 missense possibly damaging 0.77
R0551:Nup210 UTSW 6 91021484 missense possibly damaging 0.85
R0606:Nup210 UTSW 6 91026929 missense possibly damaging 0.89
R1053:Nup210 UTSW 6 91028811 missense probably benign 0.41
R1301:Nup210 UTSW 6 91042347 missense possibly damaging 0.47
R1381:Nup210 UTSW 6 91075960 missense probably damaging 0.99
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1487:Nup210 UTSW 6 91042576 missense probably damaging 1.00
R1522:Nup210 UTSW 6 91069166 missense possibly damaging 0.85
R1529:Nup210 UTSW 6 91036376 missense probably damaging 1.00
R1531:Nup210 UTSW 6 91034841 missense probably benign 0.05
R1668:Nup210 UTSW 6 91028805 missense possibly damaging 0.89
R1694:Nup210 UTSW 6 91062803 missense probably benign 0.09
R1803:Nup210 UTSW 6 91074282 missense probably damaging 0.99
R1851:Nup210 UTSW 6 91016054 missense probably damaging 1.00
R2145:Nup210 UTSW 6 91028876 missense possibly damaging 0.81
R2196:Nup210 UTSW 6 91055244 missense probably benign 0.02
R2308:Nup210 UTSW 6 91040868 missense probably benign 0.19
R2419:Nup210 UTSW 6 91017556 splice site probably benign
R2912:Nup210 UTSW 6 91026974 missense probably damaging 1.00
R3413:Nup210 UTSW 6 91025242 missense probably benign 0.00
R3718:Nup210 UTSW 6 91020180 missense probably benign 0.04
R3753:Nup210 UTSW 6 91021395 critical splice donor site probably null
R4058:Nup210 UTSW 6 91060620 missense probably benign 0.02
R4840:Nup210 UTSW 6 91031668 nonsense probably null
R4912:Nup210 UTSW 6 91017529 missense probably benign 0.01
R4967:Nup210 UTSW 6 91036469 missense possibly damaging 0.81
R4996:Nup210 UTSW 6 91053436 missense probably benign 0.16
R5074:Nup210 UTSW 6 91055327 missense probably benign 0.16
R5233:Nup210 UTSW 6 91026969 missense probably damaging 1.00
R5352:Nup210 UTSW 6 91069316 missense probably damaging 1.00
R5490:Nup210 UTSW 6 91085988 missense probably damaging 0.98
R5511:Nup210 UTSW 6 91026963 missense probably damaging 0.97
R5773:Nup210 UTSW 6 91085883 missense probably damaging 0.96
R6064:Nup210 UTSW 6 91055291 missense probably benign 0.01
R6209:Nup210 UTSW 6 91025355 missense probably benign
R6299:Nup210 UTSW 6 91074288 missense possibly damaging 0.68
R6705:Nup210 UTSW 6 91087960 missense possibly damaging 0.50
R6855:Nup210 UTSW 6 91040853 missense probably benign 0.13
R6856:Nup210 UTSW 6 91087913 nonsense probably null
R6911:Nup210 UTSW 6 91030130 missense probably damaging 0.98
R6955:Nup210 UTSW 6 91087927 missense probably damaging 1.00
R7045:Nup210 UTSW 6 91054451 missense probably damaging 1.00
R7081:Nup210 UTSW 6 91060665 missense possibly damaging 0.50
R7163:Nup210 UTSW 6 91073331 missense probably damaging 1.00
R7305:Nup210 UTSW 6 91087966 missense probably damaging 1.00
R7387:Nup210 UTSW 6 91021396 critical splice donor site probably null
R7404:Nup210 UTSW 6 91073245 missense probably benign 0.01
R7469:Nup210 UTSW 6 91018892 missense probably benign 0.08
R7603:Nup210 UTSW 6 91076697 missense probably benign 0.00
R7731:Nup210 UTSW 6 91071888 missense possibly damaging 0.50
R7822:Nup210 UTSW 6 91018777 missense possibly damaging 0.71
R7944:Nup210 UTSW 6 91073197 missense probably damaging 0.99
R8032:Nup210 UTSW 6 91074349 missense probably benign 0.02
R8081:Nup210 UTSW 6 91076675 missense probably benign 0.00
R8177:Nup210 UTSW 6 91014488 missense probably benign
R8331:Nup210 UTSW 6 91053666 missense possibly damaging 0.49
X0067:Nup210 UTSW 6 91074280 missense probably damaging 1.00
Z1177:Nup210 UTSW 6 91020185 missense probably benign
Z1177:Nup210 UTSW 6 91087907 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAAAACCCCTGAGCATGGCC -3'
(R):5'- ATGTGACTGAGTGTAAGGAGACATTC -3'

Sequencing Primer
(F):5'- TGAGCATGGCCTGAGGG -3'
(R):5'- GACATTCGAATAGTGAGTGTGAAC -3'
Posted On2020-01-23