Mutagenetix > Incidental Mutation

Incidental Mutation 'R0661:Vmn2r75'

61840

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r75

Ensembl Gene

ENSMUSG00000090436

Gene Name

vomeronasal 2, receptor 75

Synonyms

EG546981

MMRRC Submission

038846-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R0661 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

86148042-86171724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 86165658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 209 (A209V)

Ref Sequence

ENSEMBL: ENSMUSP00000126973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167830]

AlphaFold

G5E8Z7

Predicted Effect

probably benign
Transcript: ENSMUST00000167830
AA Change: A209V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: A209V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	80	466	2.8e-31	PFAM
Pfam:NCD3G	510	562	4.6e-20	PFAM
Pfam:7tm_3	593	829	7.7e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1b	T	A	3: 20,315,999	T148S	possibly damaging	Het
Anks3	A	G	16: 4,948,334	F124L	probably damaging	Het
Ar	T	A	X: 98,150,565	Y262N	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
BC051142	A	T	17: 34,459,913	I217F	possibly damaging	Het
Brip1	A	T	11: 86,110,363	I749N	possibly damaging	Het
C1ra	T	A	6: 124,522,377	H507Q	probably benign	Het
Cdk9	G	A	2: 32,709,820	T135I	probably damaging	Het
Col1a1	A	G	11: 94,949,389	T1088A	unknown	Het
Cpne2	T	C	8: 94,556,039	I283T	possibly damaging	Het
Dcaf17	T	C	2: 71,088,435	L451P	probably damaging	Het
Dhx57	C	T	17: 80,268,864	C599Y	probably damaging	Het
Drd1	T	A	13: 54,053,038	N379Y	possibly damaging	Het
Fsip2	A	G	2: 82,986,169	D4082G	possibly damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Heyl	G	T	4: 123,246,031	V128F	probably damaging	Het
Hoxd12	A	G	2: 74,675,892	E216G	probably damaging	Het
Inpp4b	C	A	8: 81,741,462	A18E	possibly damaging	Het
Invs	G	A	4: 48,421,861	R831H	probably benign	Het
Lrrk2	T	C	15: 91,787,016	V2000A	probably damaging	Het
Msh3	T	C	13: 92,345,096	N303D	possibly damaging	Het
Olfr1431	T	C	19: 12,209,704	L46P	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr743	A	G	14: 50,534,095	T228A	probably benign	Het
Pcdh18	A	C	3: 49,753,318	S902R	possibly damaging	Het
Prdm15	A	T	16: 97,829,682	V190E	probably benign	Het
Ranbp2	T	G	10: 58,478,733	S1758R	probably benign	Het
Rimbp2	A	G	5: 128,786,710	V738A	probably benign	Het
Rtl5	T	C	X: 102,070,450	H138R	possibly damaging	Het
Sec11a	A	G	7: 80,935,039	V50A	probably damaging	Het
Shroom1	T	C	11: 53,466,937	S772P	possibly damaging	Het
Slc26a6	T	C	9: 108,859,113		probably null	Het
Slf1	A	G	13: 77,083,596	W555R	probably benign	Het
Spx	A	G	6: 142,413,839	S5G	possibly damaging	Het
Tcp1	T	C	17: 12,923,313	V398A	probably benign	Het
Tm6sf1	G	A	7: 81,865,345		probably null	Het
Ufsp2	T	A	8: 45,979,233	M1K	probably null	Het
Usf1	G	A	1: 171,417,499	R196Q	probably damaging	Het
Yme1l1	T	A	2: 23,191,042	M442K	probably damaging	Het
Zfand3	A	G	17: 30,135,398	E63G	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het

Other mutations in Vmn2r75

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Vmn2r75	APN	7	86148032	unclassified	probably benign
IGL01287:Vmn2r75	APN	7	86148593	missense	probably damaging	0.97
IGL01318:Vmn2r75	APN	7	86165566	missense	probably benign	0.06
IGL01331:Vmn2r75	APN	7	86171662	nonsense	probably null
IGL01406:Vmn2r75	APN	7	86163292	splice site	probably benign
IGL01615:Vmn2r75	APN	7	86148473	missense	probably benign	0.03
IGL01657:Vmn2r75	APN	7	86164247	missense	probably damaging	1.00
IGL02237:Vmn2r75	APN	7	86165578	missense	possibly damaging	0.88
IGL02275:Vmn2r75	APN	7	86165140	missense	probably benign	0.04
IGL02307:Vmn2r75	APN	7	86165766	missense	probably benign	0.00
IGL03136:Vmn2r75	APN	7	86148703	missense	possibly damaging	0.89
IGL03160:Vmn2r75	APN	7	86148436	missense	probably damaging	1.00
IGL03244:Vmn2r75	APN	7	86171725	unclassified	probably benign
PIT4449001:Vmn2r75	UTSW	7	86165583	missense	probably damaging	1.00
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0083:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0108:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0276:Vmn2r75	UTSW	7	86148307	missense	probably benign	0.01
R0320:Vmn2r75	UTSW	7	86165080	missense	probably benign	0.36
R0471:Vmn2r75	UTSW	7	86165513	missense	probably benign	0.01
R0562:Vmn2r75	UTSW	7	86148241	nonsense	probably null
R0631:Vmn2r75	UTSW	7	86163270	missense	probably null	1.00
R0811:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0812:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0891:Vmn2r75	UTSW	7	86164268	missense	possibly damaging	0.81
R1340:Vmn2r75	UTSW	7	86148590	missense	probably damaging	0.98
R1501:Vmn2r75	UTSW	7	86165642	missense	possibly damaging	0.85
R1760:Vmn2r75	UTSW	7	86148811	missense	probably damaging	1.00
R1970:Vmn2r75	UTSW	7	86148262	missense	probably damaging	1.00
R2060:Vmn2r75	UTSW	7	86165164	missense	probably benign	0.00
R2292:Vmn2r75	UTSW	7	86148936	missense	probably damaging	1.00
R3688:Vmn2r75	UTSW	7	86148421	missense	probably damaging	0.99
R3892:Vmn2r75	UTSW	7	86164286	missense	probably null	1.00
R4532:Vmn2r75	UTSW	7	86148141	nonsense	probably null
R4583:Vmn2r75	UTSW	7	86164082	missense	possibly damaging	0.81
R4592:Vmn2r75	UTSW	7	86166286	missense	probably benign	0.00
R4792:Vmn2r75	UTSW	7	86163170	missense	possibly damaging	0.46
R4859:Vmn2r75	UTSW	7	86148403	missense	probably benign	0.35
R4896:Vmn2r75	UTSW	7	86171579	missense	probably benign	0.01
R4943:Vmn2r75	UTSW	7	86165497	missense	probably damaging	1.00
R4992:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably null
R5048:Vmn2r75	UTSW	7	86165527	missense	possibly damaging	0.66
R5063:Vmn2r75	UTSW	7	86164164	missense	probably benign
R5156:Vmn2r75	UTSW	7	86164228	missense	possibly damaging	0.51
R5243:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R5277:Vmn2r75	UTSW	7	86166292	missense	probably benign
R5574:Vmn2r75	UTSW	7	86166302	missense	probably benign	0.22
R5622:Vmn2r75	UTSW	7	86148494	missense	probably benign	0.15
R5680:Vmn2r75	UTSW	7	86171571	missense	probably benign	0.10
R5884:Vmn2r75	UTSW	7	86165370	missense	probably benign
R6021:Vmn2r75	UTSW	7	86171612	missense	probably benign	0.01
R6217:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably benign
R6242:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R6299:Vmn2r75	UTSW	7	86165274	missense	probably benign	0.12
R6441:Vmn2r75	UTSW	7	86171576	missense	probably damaging	0.99
R6495:Vmn2r75	UTSW	7	86164079	missense	probably benign	0.00
R6553:Vmn2r75	UTSW	7	86164245	missense	probably benign	0.28
R6670:Vmn2r75	UTSW	7	86148436	missense	probably damaging	1.00
R7078:Vmn2r75	UTSW	7	86166360	missense	probably damaging	1.00
R7164:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R8411:Vmn2r75	UTSW	7	86148514	missense	probably damaging	1.00
R8507:Vmn2r75	UTSW	7	86148477	nonsense	probably null
R8559:Vmn2r75	UTSW	7	86166272	missense	possibly damaging	0.65
R8677:Vmn2r75	UTSW	7	86165202	missense	possibly damaging	0.86
R8708:Vmn2r75	UTSW	7	86163268	missense	probably damaging	0.99
R8778:Vmn2r75	UTSW	7	86164289	missense	probably benign	0.40
R8968:Vmn2r75	UTSW	7	86171557	nonsense	probably null
R9145:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R9316:Vmn2r75	UTSW	7	86148105	missense	possibly damaging	0.63
R9363:Vmn2r75	UTSW	7	86166215	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACCCAGATTCTCCAAATGCCTTCAG -3'
(R):5'- GCATTGATACACTTTGCTCAAGCACAC -3'

Sequencing Primer
(F):5'- GGGAGAGTCTTTGTCTCCATAAAC -3'
(R):5'- TGCTCAAGCACACTCTGATG -3'

Posted On

2013-07-30