Incidental Mutation 'R8039:Itpr1'
ID 618400
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission 067476-MU
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene? Probably essential (E-score: 0.752) question?
Stock # R8039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 108213096-108551109 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108386628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 737 (L737P)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
AlphaFold no structure available at present
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032192
AA Change: L737P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: L737P

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203615
AA Change: L737P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: L737P

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,471,120 (GRCm38) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,413,820 (GRCm38) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,381,333 (GRCm38) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,399,361 (GRCm38) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,381,208 (GRCm38) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,339,624 (GRCm38) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,386,727 (GRCm38) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,488,496 (GRCm38) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,473,599 (GRCm38) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,381,032 (GRCm38) nonsense probably null
IGL01969:Itpr1 APN 6 108,377,691 (GRCm38) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,389,483 (GRCm38) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,549,820 (GRCm38) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,417,923 (GRCm38) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,339,517 (GRCm38) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,489,922 (GRCm38) splice site probably null
IGL02568:Itpr1 APN 6 108,339,554 (GRCm38) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,381,315 (GRCm38) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,417,981 (GRCm38) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,523,401 (GRCm38) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,380,910 (GRCm38) unclassified probably benign
aboriginal UTSW 6 108,515,947 (GRCm38) missense probably benign
approximation UTSW 6 108,394,841 (GRCm38) missense probably benign
estimate UTSW 6 108,389,553 (GRCm38) missense probably null 1.00
icarus UTSW 6 108,410,900 (GRCm38) missense probably damaging 1.00
marsupialized UTSW 6 108,394,073 (GRCm38) splice site probably null
primordial UTSW 6 108,518,755 (GRCm38) missense probably benign 0.06
roo UTSW 6 108,410,867 (GRCm38) missense probably benign 0.00
wallaby UTSW 6 108,389,387 (GRCm38) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,381,257 (GRCm38) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,493,757 (GRCm38) nonsense probably null
R0019:Itpr1 UTSW 6 108,354,626 (GRCm38) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,471,209 (GRCm38) splice site probably benign
R0129:Itpr1 UTSW 6 108,349,676 (GRCm38) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,488,482 (GRCm38) splice site probably benign
R0244:Itpr1 UTSW 6 108,473,589 (GRCm38) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,378,167 (GRCm38) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,515,748 (GRCm38) splice site probably benign
R0647:Itpr1 UTSW 6 108,383,698 (GRCm38) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,410,900 (GRCm38) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,349,629 (GRCm38) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,510,696 (GRCm38) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,339,621 (GRCm38) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,389,553 (GRCm38) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,389,553 (GRCm38) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,386,648 (GRCm38) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,386,648 (GRCm38) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,349,659 (GRCm38) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,482,897 (GRCm38) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,386,706 (GRCm38) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,493,755 (GRCm38) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,440,536 (GRCm38) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,386,853 (GRCm38) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,378,309 (GRCm38) unclassified probably benign
R2166:Itpr1 UTSW 6 108,388,225 (GRCm38) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,493,755 (GRCm38) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,369,110 (GRCm38) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,406,109 (GRCm38) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,349,680 (GRCm38) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,381,270 (GRCm38) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,394,841 (GRCm38) missense probably benign
R4081:Itpr1 UTSW 6 108,391,835 (GRCm38) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,394,355 (GRCm38) missense probably benign
R4406:Itpr1 UTSW 6 108,354,663 (GRCm38) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,432,686 (GRCm38) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,481,223 (GRCm38) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,481,293 (GRCm38) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,410,931 (GRCm38) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,349,632 (GRCm38) missense probably benign 0.29
R4836:Itpr1 UTSW 6 108,389,537 (GRCm38) missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108,410,867 (GRCm38) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,482,906 (GRCm38) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,440,558 (GRCm38) nonsense probably null
R5076:Itpr1 UTSW 6 108,405,529 (GRCm38) splice site probably null
R5088:Itpr1 UTSW 6 108,389,387 (GRCm38) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,542,062 (GRCm38) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,406,145 (GRCm38) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,356,511 (GRCm38) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,393,961 (GRCm38) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,387,498 (GRCm38) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,519,424 (GRCm38) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,493,794 (GRCm38) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,488,600 (GRCm38) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,352,143 (GRCm38) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,510,738 (GRCm38) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,473,529 (GRCm38) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,489,797 (GRCm38) intron probably benign
R5929:Itpr1 UTSW 6 108,423,336 (GRCm38) missense probably benign
R5956:Itpr1 UTSW 6 108,506,027 (GRCm38) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,518,755 (GRCm38) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,388,284 (GRCm38) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,369,116 (GRCm38) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,378,203 (GRCm38) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,505,903 (GRCm38) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,417,972 (GRCm38) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,388,276 (GRCm38) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,363,683 (GRCm38) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,394,073 (GRCm38) splice site probably null
R6806:Itpr1 UTSW 6 108,515,947 (GRCm38) missense probably benign
R6838:Itpr1 UTSW 6 108,471,191 (GRCm38) missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108,388,192 (GRCm38) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,481,394 (GRCm38) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,431,498 (GRCm38) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,388,296 (GRCm38) missense probably benign
R7116:Itpr1 UTSW 6 108,481,268 (GRCm38) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,394,407 (GRCm38) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,386,640 (GRCm38) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,378,190 (GRCm38) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,517,620 (GRCm38) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,542,024 (GRCm38) missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108,438,331 (GRCm38) missense probably benign 0.28
R7449:Itpr1 UTSW 6 108,389,384 (GRCm38) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,403,396 (GRCm38) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,383,678 (GRCm38) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,523,348 (GRCm38) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,482,931 (GRCm38) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,387,369 (GRCm38) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,523,405 (GRCm38) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,417,948 (GRCm38) missense possibly damaging 0.88
R8136:Itpr1 UTSW 6 108,438,360 (GRCm38) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,394,865 (GRCm38) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,386,697 (GRCm38) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,388,229 (GRCm38) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,510,738 (GRCm38) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,363,620 (GRCm38) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,519,348 (GRCm38) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,393,967 (GRCm38) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,523,366 (GRCm38) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,377,802 (GRCm38) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,388,211 (GRCm38) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,378,198 (GRCm38) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,493,705 (GRCm38) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,387,391 (GRCm38) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,489,849 (GRCm38) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,394,023 (GRCm38) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,352,018 (GRCm38) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,349,677 (GRCm38) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,413,876 (GRCm38) missense probably benign
R9428:Itpr1 UTSW 6 108,401,347 (GRCm38) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,416,909 (GRCm38) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,405,520 (GRCm38) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,394,884 (GRCm38) missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108,401,350 (GRCm38) missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108,405,520 (GRCm38) missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108,406,102 (GRCm38) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,510,834 (GRCm38) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,499,149 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACCCTTACTCTGGCATAC -3'
(R):5'- GGCATATTTCACAGGTGTCACC -3'

Sequencing Primer
(F):5'- GACCCTTACTCTGGCATACTATAAAC -3'
(R):5'- GTCACCTGCTCTTGGGGATC -3'
Posted On 2020-01-23