Incidental Mutation 'R8039:Ttyh1'
ID618404
Institutional Source Beutler Lab
Gene Symbol Ttyh1
Ensembl Gene ENSMUSG00000030428
Gene Nametweety family member 1
Synonyms6330408P11Rik, tty, 4930459B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4119408-4136708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4122541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 64 (V64A)
Ref Sequence ENSEMBL: ENSMUSP00000078384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000153673] [ENSMUST00000206869] [ENSMUST00000206987]
AlphaFold Q9D3A9
Predicted Effect possibly damaging
Transcript: ENSMUST00000032594
AA Change: V31A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428
AA Change: V31A

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079415
AA Change: V64A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119661
AA Change: V64A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129423
AA Change: V64A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153673
AA Change: V64A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Tweety 26 103 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206869
Predicted Effect probably benign
Transcript: ENSMUST00000206987
AA Change: V64A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Ttyh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ttyh1 APN 7 4124657 missense probably damaging 1.00
IGL01730:Ttyh1 APN 7 4125721 missense possibly damaging 0.90
IGL02052:Ttyh1 APN 7 4130574 unclassified probably benign
IGL02410:Ttyh1 APN 7 4133899 utr 3 prime probably benign
IGL02651:Ttyh1 APN 7 4124679 missense probably damaging 1.00
PIT4468001:Ttyh1 UTSW 7 4119772 missense possibly damaging 0.49
R0137:Ttyh1 UTSW 7 4124720 missense possibly damaging 0.95
R1699:Ttyh1 UTSW 7 4119696 missense possibly damaging 0.79
R1739:Ttyh1 UTSW 7 4129349 missense probably benign 0.18
R1865:Ttyh1 UTSW 7 4119731 missense probably damaging 1.00
R2258:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2259:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2260:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R3027:Ttyh1 UTSW 7 4119722 missense probably benign 0.31
R3426:Ttyh1 UTSW 7 4133219 critical splice donor site probably null
R3939:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R3941:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R4328:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4329:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4527:Ttyh1 UTSW 7 4119764 missense probably damaging 1.00
R4849:Ttyh1 UTSW 7 4122534 missense possibly damaging 0.84
R4898:Ttyh1 UTSW 7 4133736 missense probably benign 0.03
R4931:Ttyh1 UTSW 7 4133944 utr 3 prime probably benign
R4960:Ttyh1 UTSW 7 4128226 missense probably damaging 1.00
R6158:Ttyh1 UTSW 7 4125562 missense probably benign 0.00
R6362:Ttyh1 UTSW 7 4129324 missense possibly damaging 0.67
R6799:Ttyh1 UTSW 7 4133222 splice site probably null
R6823:Ttyh1 UTSW 7 4122529 missense probably damaging 0.97
R6897:Ttyh1 UTSW 7 4124650 utr 3 prime probably benign
R7070:Ttyh1 UTSW 7 4133364 missense probably damaging 0.99
R7236:Ttyh1 UTSW 7 4133664 missense probably benign 0.00
R7287:Ttyh1 UTSW 7 4125658 missense probably benign 0.02
R8056:Ttyh1 UTSW 7 4124623 intron probably benign
R8236:Ttyh1 UTSW 7 4125548 missense probably benign 0.02
R8684:Ttyh1 UTSW 7 4130792 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCCTTGGGGCATGTTTC -3'
(R):5'- ACTCTTAGTGCCTAGCGGTTC -3'

Sequencing Primer
(F):5'- CATTTCAATTGCCATGCAGCTGAG -3'
(R):5'- CCAAGGTCTCTAGAAAAAGACAGCG -3'
Posted On2020-01-23