Mutagenetix > Incidental Mutation

Incidental Mutation 'R8039:Anpep'

618406

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

067476-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8039 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 79839400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably null
Transcript: ENSMUST00000049004

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107392

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,943,214	V1140E	probably benign	Het
Abca17	T	C	17: 24,328,725	H225R	probably damaging	Het
Adgrb2	T	A	4: 130,022,268	L1451Q	probably damaging	Het
Afdn	T	C	17: 13,899,141	L1713P	probably damaging	Het
Agr2	A	T	12: 35,995,559	I15F	probably benign	Het
Agrn	T	C	4: 156,169,011	T1808A	probably benign	Het
Akap6	A	G	12: 53,141,676	I1958V	probably benign	Het
Ankrd60	C	A	2: 173,572,491		probably null	Het
Apoa4	A	T	9: 46,242,293	D64V	possibly damaging	Het
Arhgef26	C	A	3: 62,339,930	T145N	probably benign	Het
Art1	A	T	7: 102,106,845	Q81L	probably benign	Het
Astl	A	T	2: 127,343,983	S71C	probably damaging	Het
Atp2a1	A	G	7: 126,448,805	I611T	probably damaging	Het
Cacna2d2	T	A	9: 107,527,433	V1139D	possibly damaging	Het
Chst10	T	A	1: 38,866,031	K198*	probably null	Het
Ckmt2	G	A	13: 91,863,312	H60Y	possibly damaging	Het
Coq7	G	C	7: 118,533,246	S2R	possibly damaging	Het
Cspp1	T	A	1: 10,113,013	D814E	probably benign	Het
Cyp2c54	CCTCTTTCATAGCTCT	CCTCT	19: 40,073,732		probably null	Het
Daam2	C	A	17: 49,464,538	G860V	probably damaging	Het
Ecm2	A	T	13: 49,514,850	I10F	probably benign	Het
Epb41l1	A	T	2: 156,506,412	D312V	probably damaging	Het
Epsti1	G	A	14: 77,931,301	R126H	probably damaging	Het
Erc1	A	T	6: 119,773,665	Y367*	probably null	Het
Erh	T	A	12: 80,637,578	R42W	probably damaging	Het
Fam124a	C	T	14: 62,605,876	Q278*	probably null	Het
Fam155a	T	C	8: 9,207,892	T419A	probably benign	Het
Fbxo3	T	A	2: 104,054,941	L385Q	probably damaging	Het
Fbxo31	T	A	8: 121,559,055	T219S	probably damaging	Het
Fstl5	T	G	3: 76,648,418	V534G	possibly damaging	Het
Gatsl3	G	T	11: 4,221,639	A288S	probably damaging	Het
Gbp2b	A	T	3: 142,618,164	I577F	probably benign	Het
Gbp8	A	T	5: 105,050,917	L44*	probably null	Het
Gck	C	T	11: 5,910,301	A114T	probably benign	Het
Gm16486	T	C	8: 70,710,906	V916A	probably benign	Het
Gtf2i	A	G	5: 134,255,834	V537A	possibly damaging	Het
Iqcm	C	A	8: 75,763,105	H400Q	probably damaging	Het
Itpr1	T	C	6: 108,386,628	L737P	probably damaging	Het
Jakmip1	A	G	5: 37,100,772	E254G	probably damaging	Het
Kif15	A	T	9: 123,007,425	R1095W	possibly damaging	Het
Klhdc8a	G	A	1: 132,303,108	R237Q	probably benign	Het
Klhl38	T	C	15: 58,322,862	E157G	probably benign	Het
Klrk1	T	A	6: 129,612,823	N221I	probably benign	Het
Lhx8	A	T	3: 154,306,939	H345Q	probably damaging	Het
Lims1	T	A	10: 58,409,672	N174K	probably benign	Het
Madd	T	A	2: 91,167,061	Q754L	probably benign	Het
Mau2	T	C	8: 70,019,790	D581G	probably damaging	Het
Miga1	A	T	3: 152,276,756	I561N	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mob3c	T	C	4: 115,831,687	V139A	probably benign	Het
Nadk	G	T	4: 155,577,067	D17Y	probably benign	Het
Ncapd2	C	T	6: 125,181,026	V380I	probably damaging	Het
Nes	G	A	3: 87,977,008	R858K	probably benign	Het
Nphp3	T	C	9: 104,031,963	S791P	probably benign	Het
Nup210	T	C	6: 91,070,233	T496A	probably benign	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1186	C	T	2: 88,525,871	T96I	probably benign	Het
Olfr220	T	A	1: 174,449,596	S324R	unknown	Het
Olfr914	T	A	9: 38,607,389	M308K	probably benign	Het
Ovgp1	T	A	3: 105,976,023	S105T	probably benign	Het
Pbld2	T	A	10: 63,047,992	C79S	probably damaging	Het
Pik3cd	T	A	4: 149,659,866	M143L	possibly damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Poln	A	G	5: 34,122,672	V282A	probably benign	Het
Ppp1r11	T	C	17: 36,951,446	T21A	probably damaging	Het
Prpf8	T	A	11: 75,502,542	I1664N	possibly damaging	Het
Prr29	C	T	11: 106,376,912	A161V	probably benign	Het
Rasa3	T	C	8: 13,588,931	D292G	probably damaging	Het
Rnf25	T	C	1: 74,593,964	T411A	probably damaging	Het
Rraga	C	T	4: 86,575,980	T21I	probably damaging	Het
Setdb2	T	A	14: 59,402,375	Y673F	probably damaging	Het
Sf3a1	C	T	11: 4,167,787	T183I	probably damaging	Het
Shank3	A	T	15: 89,505,439	H413L	probably damaging	Het
Slc30a5	A	G	13: 100,813,681		probably null	Het
Slc6a18	T	C	13: 73,665,626	S523G	probably benign	Het
Spaca1	C	T	4: 34,044,207	V96I	probably damaging	Het
Sycp2	C	T	2: 178,374,585	A695T	probably benign	Het
Tnrc18	C	A	5: 142,732,052	G2216C	unknown	Het
Trak2	T	C	1: 58,946,288	N17S	probably benign	Het
Ttn	T	A	2: 76,878,432	N8792I	unknown	Het
Ttyh1	T	C	7: 4,122,541	V64A	probably benign	Het
Usb1	T	A	8: 95,333,413	S50R	probably damaging	Het
Ush2a	T	A	1: 188,957,373	I5044N	probably damaging	Het
Vmn1r84	A	T	7: 12,362,008	F253I	possibly damaging	Het
Vmn2r99	T	C	17: 19,380,040	I442T	probably benign	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
R9570:Anpep	UTSW	7	79826913	missense	probably benign	0.00
R9769:Anpep	UTSW	7	79838730	missense	probably damaging	1.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCAAAGACCAGGGAGCTCTC -3'
(R):5'- GTTGGTCTCCATCCTGACTTATCAG -3'

Sequencing Primer
(F):5'- AGCTCTCACGGTAGGTCAC -3'
(R):5'- TGACTTATCAGGGACCTCTAGC -3'

Posted On

2020-01-23