Incidental Mutation 'R8039:Iqcn'
ID 618414
Institutional Source Beutler Lab
Gene Symbol Iqcn
Ensembl Gene ENSMUSG00000110622
Gene Name IQ motif containing N
Synonyms Gm16486
MMRRC Submission 067476-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71156106-71170299 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71163555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 916 (V916A)
Ref Sequence ENSEMBL: ENSMUSP00000148728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000212436]
AlphaFold A0A1D5RMD1
Predicted Effect probably benign
Transcript: ENSMUST00000212436
AA Change: V916A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,699 (GRCm39) H225R probably damaging Het
Adgrb2 T A 4: 129,916,061 (GRCm39) L1451Q probably damaging Het
Afdn T C 17: 14,119,403 (GRCm39) L1713P probably damaging Het
Agr2 A T 12: 36,045,558 (GRCm39) I15F probably benign Het
Agrn T C 4: 156,253,468 (GRCm39) T1808A probably benign Het
Akap6 A G 12: 53,188,459 (GRCm39) I1958V probably benign Het
Ankrd60 C A 2: 173,414,284 (GRCm39) probably null Het
Anpep A G 7: 79,489,148 (GRCm39) probably null Het
Apoa4 A T 9: 46,153,591 (GRCm39) D64V possibly damaging Het
Arhgef26 C A 3: 62,247,351 (GRCm39) T145N probably benign Het
Art1 A T 7: 101,756,052 (GRCm39) Q81L probably benign Het
Astl A T 2: 127,185,903 (GRCm39) S71C probably damaging Het
Atp2a1 A G 7: 126,047,977 (GRCm39) I611T probably damaging Het
Bltp1 T A 3: 36,997,363 (GRCm39) V1140E probably benign Het
Cacna2d2 T A 9: 107,404,632 (GRCm39) V1139D possibly damaging Het
Castor1 G T 11: 4,171,639 (GRCm39) A288S probably damaging Het
Chst10 T A 1: 38,905,112 (GRCm39) K198* probably null Het
Ckmt2 G A 13: 92,011,431 (GRCm39) H60Y possibly damaging Het
Coq7 G C 7: 118,132,469 (GRCm39) S2R possibly damaging Het
Cspp1 T A 1: 10,183,238 (GRCm39) D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,062,176 (GRCm39) probably null Het
Daam2 C A 17: 49,771,566 (GRCm39) G860V probably damaging Het
Ecm2 A T 13: 49,668,326 (GRCm39) I10F probably benign Het
Epb41l1 A T 2: 156,348,332 (GRCm39) D312V probably damaging Het
Epsti1 G A 14: 78,168,741 (GRCm39) R126H probably damaging Het
Erc1 A T 6: 119,750,626 (GRCm39) Y367* probably null Het
Erh T A 12: 80,684,352 (GRCm39) R42W probably damaging Het
Fam124a C T 14: 62,843,325 (GRCm39) Q278* probably null Het
Fbxo3 T A 2: 103,885,286 (GRCm39) L385Q probably damaging Het
Fbxo31 T A 8: 122,285,794 (GRCm39) T219S probably damaging Het
Fstl5 T G 3: 76,555,725 (GRCm39) V534G possibly damaging Het
Gbp2b A T 3: 142,323,925 (GRCm39) I577F probably benign Het
Gbp8 A T 5: 105,198,783 (GRCm39) L44* probably null Het
Gck C T 11: 5,860,301 (GRCm39) A114T probably benign Het
Gtf2i A G 5: 134,284,688 (GRCm39) V537A possibly damaging Het
Iqcm C A 8: 76,489,733 (GRCm39) H400Q probably damaging Het
Itpr1 T C 6: 108,363,589 (GRCm39) L737P probably damaging Het
Jakmip1 A G 5: 37,258,116 (GRCm39) E254G probably damaging Het
Kif15 A T 9: 122,836,490 (GRCm39) R1095W possibly damaging Het
Klhdc8a G A 1: 132,230,846 (GRCm39) R237Q probably benign Het
Klhl38 T C 15: 58,186,258 (GRCm39) E157G probably benign Het
Klrk1 T A 6: 129,589,786 (GRCm39) N221I probably benign Het
Lhx8 A T 3: 154,012,576 (GRCm39) H345Q probably damaging Het
Lims1 T A 10: 58,245,494 (GRCm39) N174K probably benign Het
Madd T A 2: 90,997,406 (GRCm39) Q754L probably benign Het
Mau2 T C 8: 70,472,440 (GRCm39) D581G probably damaging Het
Miga1 A T 3: 151,982,393 (GRCm39) I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mob3c T C 4: 115,688,884 (GRCm39) V139A probably benign Het
Nadk G T 4: 155,661,524 (GRCm39) D17Y probably benign Het
Nalf1 T C 8: 9,257,892 (GRCm39) T419A probably benign Het
Ncapd2 C T 6: 125,157,989 (GRCm39) V380I probably damaging Het
Nes G A 3: 87,884,315 (GRCm39) R858K probably benign Het
Nphp3 T C 9: 103,909,162 (GRCm39) S791P probably benign Het
Nup210 T C 6: 91,047,215 (GRCm39) T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4c100 C T 2: 88,356,215 (GRCm39) T96I probably benign Het
Or6y1 T A 1: 174,277,162 (GRCm39) S324R unknown Het
Or8b50 T A 9: 38,518,685 (GRCm39) M308K probably benign Het
Ovgp1 T A 3: 105,883,339 (GRCm39) S105T probably benign Het
Pbld2 T A 10: 62,883,771 (GRCm39) C79S probably damaging Het
Pik3cd T A 4: 149,744,323 (GRCm39) M143L possibly damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Poln A G 5: 34,280,016 (GRCm39) V282A probably benign Het
Ppp1r11 T C 17: 37,262,338 (GRCm39) T21A probably damaging Het
Prpf8 T A 11: 75,393,368 (GRCm39) I1664N possibly damaging Het
Prr29 C T 11: 106,267,738 (GRCm39) A161V probably benign Het
Rasa3 T C 8: 13,638,931 (GRCm39) D292G probably damaging Het
Rnf25 T C 1: 74,633,123 (GRCm39) T411A probably damaging Het
Rraga C T 4: 86,494,217 (GRCm39) T21I probably damaging Het
Setdb2 T A 14: 59,639,824 (GRCm39) Y673F probably damaging Het
Sf3a1 C T 11: 4,117,787 (GRCm39) T183I probably damaging Het
Shank3 A T 15: 89,389,642 (GRCm39) H413L probably damaging Het
Slc30a5 A G 13: 100,950,189 (GRCm39) probably null Het
Slc6a18 T C 13: 73,813,745 (GRCm39) S523G probably benign Het
Spaca1 C T 4: 34,044,207 (GRCm39) V96I probably damaging Het
Sycp2 C T 2: 178,016,378 (GRCm39) A695T probably benign Het
Tnrc18 C A 5: 142,717,807 (GRCm39) G2216C unknown Het
Trak2 T C 1: 58,985,447 (GRCm39) N17S probably benign Het
Ttn T A 2: 76,708,776 (GRCm39) N8792I unknown Het
Ttyh1 T C 7: 4,125,540 (GRCm39) V64A probably benign Het
Usb1 T A 8: 96,060,041 (GRCm39) S50R probably damaging Het
Ush2a T A 1: 188,689,570 (GRCm39) I5044N probably damaging Het
Vmn1r84 A T 7: 12,095,935 (GRCm39) F253I possibly damaging Het
Vmn2r99 T C 17: 19,600,302 (GRCm39) I442T probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Other mutations in Iqcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6811:Iqcn UTSW 8 71,169,422 (GRCm39) missense probably benign 0.05
R6850:Iqcn UTSW 8 71,163,425 (GRCm39) missense probably damaging 0.97
R7029:Iqcn UTSW 8 71,161,511 (GRCm39) missense possibly damaging 0.46
R7203:Iqcn UTSW 8 71,169,597 (GRCm39) missense probably benign 0.26
R7260:Iqcn UTSW 8 71,161,397 (GRCm39) missense probably benign 0.00
R7263:Iqcn UTSW 8 71,163,425 (GRCm39) missense possibly damaging 0.66
R7327:Iqcn UTSW 8 71,169,453 (GRCm39) missense possibly damaging 0.65
R7401:Iqcn UTSW 8 71,169,921 (GRCm39) missense probably benign 0.03
R7542:Iqcn UTSW 8 71,161,415 (GRCm39) missense possibly damaging 0.66
R7572:Iqcn UTSW 8 71,162,075 (GRCm39) missense probably benign 0.00
R7733:Iqcn UTSW 8 71,170,100 (GRCm39) missense possibly damaging 0.95
R7873:Iqcn UTSW 8 71,163,989 (GRCm39) missense probably benign 0.29
R8015:Iqcn UTSW 8 71,169,441 (GRCm39) missense probably benign 0.02
R8061:Iqcn UTSW 8 71,161,224 (GRCm39) missense probably benign
R8094:Iqcn UTSW 8 71,162,067 (GRCm39) missense probably benign
R8498:Iqcn UTSW 8 71,162,625 (GRCm39) missense probably benign 0.19
R8542:Iqcn UTSW 8 71,166,520 (GRCm39) splice site probably null
R8709:Iqcn UTSW 8 71,162,372 (GRCm39) missense possibly damaging 0.83
R9141:Iqcn UTSW 8 71,162,421 (GRCm39) missense probably benign 0.15
R9313:Iqcn UTSW 8 71,161,353 (GRCm39) missense probably damaging 1.00
R9324:Iqcn UTSW 8 71,161,794 (GRCm39) missense possibly damaging 0.92
Z1177:Iqcn UTSW 8 71,169,752 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTTAGCACTGGATCCCGTG -3'
(R):5'- TCAGTGCCATTCCCAGCATG -3'

Sequencing Primer
(F):5'- CGTGCCAAGCCAGATGACAG -3'
(R):5'- ATTCCCAGCATGCCTTGGG -3'
Posted On 2020-01-23