Incidental Mutation 'R8039:Usb1'
ID 618416
Institutional Source Beutler Lab
Gene Symbol Usb1
Ensembl Gene ENSMUSG00000031792
Gene Name U6 snRNA biogenesis 1
Synonyms AA960436
MMRRC Submission 067476-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 96058912-96074135 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96060041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 50 (S50R)
Ref Sequence ENSEMBL: ENSMUSP00000034245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034245] [ENSMUST00000057717] [ENSMUST00000126180] [ENSMUST00000213059]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034245
AA Change: S50R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034245
Gene: ENSMUSG00000031792
AA Change: S50R

DomainStartEndE-ValueType
Pfam:HVSL 45 265 6.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057717
SMART Domains Protein: ENSMUSP00000053397
Gene: ENSMUSG00000046556

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Blast:ZnF_C2H2 75 99 6e-7 BLAST
ZnF_C2H2 103 123 7.57e1 SMART
ZnF_C2H2 131 153 8.67e-1 SMART
low complexity region 168 189 N/A INTRINSIC
ZnF_C2H2 201 223 9.73e-4 SMART
ZnF_C2H2 229 251 1.47e-3 SMART
ZnF_C2H2 257 279 1.12e-3 SMART
ZnF_C2H2 314 336 6.42e-4 SMART
ZnF_C2H2 342 364 1.2e-3 SMART
ZnF_C2H2 370 392 8.81e-2 SMART
ZnF_C2H2 398 418 2.75e1 SMART
ZnF_C2H2 427 449 1.84e-4 SMART
ZnF_C2H2 457 477 1.27e2 SMART
ZnF_C2H2 485 507 2.79e-4 SMART
ZnF_C2H2 513 535 6.42e-4 SMART
ZnF_C2H2 541 563 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126180
SMART Domains Protein: ENSMUSP00000122529
Gene: ENSMUSG00000031792

DomainStartEndE-ValueType
Pfam:HVSL 1 113 6.4e-36 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213059
AA Change: V44E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,699 (GRCm39) H225R probably damaging Het
Adgrb2 T A 4: 129,916,061 (GRCm39) L1451Q probably damaging Het
Afdn T C 17: 14,119,403 (GRCm39) L1713P probably damaging Het
Agr2 A T 12: 36,045,558 (GRCm39) I15F probably benign Het
Agrn T C 4: 156,253,468 (GRCm39) T1808A probably benign Het
Akap6 A G 12: 53,188,459 (GRCm39) I1958V probably benign Het
Ankrd60 C A 2: 173,414,284 (GRCm39) probably null Het
Anpep A G 7: 79,489,148 (GRCm39) probably null Het
Apoa4 A T 9: 46,153,591 (GRCm39) D64V possibly damaging Het
Arhgef26 C A 3: 62,247,351 (GRCm39) T145N probably benign Het
Art1 A T 7: 101,756,052 (GRCm39) Q81L probably benign Het
Astl A T 2: 127,185,903 (GRCm39) S71C probably damaging Het
Atp2a1 A G 7: 126,047,977 (GRCm39) I611T probably damaging Het
Bltp1 T A 3: 36,997,363 (GRCm39) V1140E probably benign Het
Cacna2d2 T A 9: 107,404,632 (GRCm39) V1139D possibly damaging Het
Castor1 G T 11: 4,171,639 (GRCm39) A288S probably damaging Het
Chst10 T A 1: 38,905,112 (GRCm39) K198* probably null Het
Ckmt2 G A 13: 92,011,431 (GRCm39) H60Y possibly damaging Het
Coq7 G C 7: 118,132,469 (GRCm39) S2R possibly damaging Het
Cspp1 T A 1: 10,183,238 (GRCm39) D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,062,176 (GRCm39) probably null Het
Daam2 C A 17: 49,771,566 (GRCm39) G860V probably damaging Het
Ecm2 A T 13: 49,668,326 (GRCm39) I10F probably benign Het
Epb41l1 A T 2: 156,348,332 (GRCm39) D312V probably damaging Het
Epsti1 G A 14: 78,168,741 (GRCm39) R126H probably damaging Het
Erc1 A T 6: 119,750,626 (GRCm39) Y367* probably null Het
Erh T A 12: 80,684,352 (GRCm39) R42W probably damaging Het
Fam124a C T 14: 62,843,325 (GRCm39) Q278* probably null Het
Fbxo3 T A 2: 103,885,286 (GRCm39) L385Q probably damaging Het
Fbxo31 T A 8: 122,285,794 (GRCm39) T219S probably damaging Het
Fstl5 T G 3: 76,555,725 (GRCm39) V534G possibly damaging Het
Gbp2b A T 3: 142,323,925 (GRCm39) I577F probably benign Het
Gbp8 A T 5: 105,198,783 (GRCm39) L44* probably null Het
Gck C T 11: 5,860,301 (GRCm39) A114T probably benign Het
Gtf2i A G 5: 134,284,688 (GRCm39) V537A possibly damaging Het
Iqcm C A 8: 76,489,733 (GRCm39) H400Q probably damaging Het
Iqcn T C 8: 71,163,555 (GRCm39) V916A probably benign Het
Itpr1 T C 6: 108,363,589 (GRCm39) L737P probably damaging Het
Jakmip1 A G 5: 37,258,116 (GRCm39) E254G probably damaging Het
Kif15 A T 9: 122,836,490 (GRCm39) R1095W possibly damaging Het
Klhdc8a G A 1: 132,230,846 (GRCm39) R237Q probably benign Het
Klhl38 T C 15: 58,186,258 (GRCm39) E157G probably benign Het
Klrk1 T A 6: 129,589,786 (GRCm39) N221I probably benign Het
Lhx8 A T 3: 154,012,576 (GRCm39) H345Q probably damaging Het
Lims1 T A 10: 58,245,494 (GRCm39) N174K probably benign Het
Madd T A 2: 90,997,406 (GRCm39) Q754L probably benign Het
Mau2 T C 8: 70,472,440 (GRCm39) D581G probably damaging Het
Miga1 A T 3: 151,982,393 (GRCm39) I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mob3c T C 4: 115,688,884 (GRCm39) V139A probably benign Het
Nadk G T 4: 155,661,524 (GRCm39) D17Y probably benign Het
Nalf1 T C 8: 9,257,892 (GRCm39) T419A probably benign Het
Ncapd2 C T 6: 125,157,989 (GRCm39) V380I probably damaging Het
Nes G A 3: 87,884,315 (GRCm39) R858K probably benign Het
Nphp3 T C 9: 103,909,162 (GRCm39) S791P probably benign Het
Nup210 T C 6: 91,047,215 (GRCm39) T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4c100 C T 2: 88,356,215 (GRCm39) T96I probably benign Het
Or6y1 T A 1: 174,277,162 (GRCm39) S324R unknown Het
Or8b50 T A 9: 38,518,685 (GRCm39) M308K probably benign Het
Ovgp1 T A 3: 105,883,339 (GRCm39) S105T probably benign Het
Pbld2 T A 10: 62,883,771 (GRCm39) C79S probably damaging Het
Pik3cd T A 4: 149,744,323 (GRCm39) M143L possibly damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Poln A G 5: 34,280,016 (GRCm39) V282A probably benign Het
Ppp1r11 T C 17: 37,262,338 (GRCm39) T21A probably damaging Het
Prpf8 T A 11: 75,393,368 (GRCm39) I1664N possibly damaging Het
Prr29 C T 11: 106,267,738 (GRCm39) A161V probably benign Het
Rasa3 T C 8: 13,638,931 (GRCm39) D292G probably damaging Het
Rnf25 T C 1: 74,633,123 (GRCm39) T411A probably damaging Het
Rraga C T 4: 86,494,217 (GRCm39) T21I probably damaging Het
Setdb2 T A 14: 59,639,824 (GRCm39) Y673F probably damaging Het
Sf3a1 C T 11: 4,117,787 (GRCm39) T183I probably damaging Het
Shank3 A T 15: 89,389,642 (GRCm39) H413L probably damaging Het
Slc30a5 A G 13: 100,950,189 (GRCm39) probably null Het
Slc6a18 T C 13: 73,813,745 (GRCm39) S523G probably benign Het
Spaca1 C T 4: 34,044,207 (GRCm39) V96I probably damaging Het
Sycp2 C T 2: 178,016,378 (GRCm39) A695T probably benign Het
Tnrc18 C A 5: 142,717,807 (GRCm39) G2216C unknown Het
Trak2 T C 1: 58,985,447 (GRCm39) N17S probably benign Het
Ttn T A 2: 76,708,776 (GRCm39) N8792I unknown Het
Ttyh1 T C 7: 4,125,540 (GRCm39) V64A probably benign Het
Ush2a T A 1: 188,689,570 (GRCm39) I5044N probably damaging Het
Vmn1r84 A T 7: 12,095,935 (GRCm39) F253I possibly damaging Het
Vmn2r99 T C 17: 19,600,302 (GRCm39) I442T probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Other mutations in Usb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03164:Usb1 APN 8 96,060,112 (GRCm39) missense probably damaging 1.00
R0276:Usb1 UTSW 8 96,060,085 (GRCm39) missense probably damaging 1.00
R0385:Usb1 UTSW 8 96,071,946 (GRCm39) missense probably damaging 1.00
R0730:Usb1 UTSW 8 96,070,669 (GRCm39) missense probably damaging 1.00
R0801:Usb1 UTSW 8 96,060,168 (GRCm39) splice site probably null
R1497:Usb1 UTSW 8 96,065,325 (GRCm39) missense probably benign 0.00
R2230:Usb1 UTSW 8 96,070,674 (GRCm39) missense probably damaging 1.00
R2231:Usb1 UTSW 8 96,070,674 (GRCm39) missense probably damaging 1.00
R2232:Usb1 UTSW 8 96,070,674 (GRCm39) missense probably damaging 1.00
R2402:Usb1 UTSW 8 96,069,759 (GRCm39) missense probably benign 0.06
R2507:Usb1 UTSW 8 96,069,752 (GRCm39) missense probably damaging 1.00
R3821:Usb1 UTSW 8 96,060,061 (GRCm39) missense probably benign 0.35
R5085:Usb1 UTSW 8 96,070,679 (GRCm39) missense probably damaging 0.98
R5834:Usb1 UTSW 8 96,060,161 (GRCm39) utr 3 prime probably benign
R7398:Usb1 UTSW 8 96,071,931 (GRCm39) missense probably damaging 1.00
R8816:Usb1 UTSW 8 96,071,984 (GRCm39) missense probably benign 0.13
R9716:Usb1 UTSW 8 96,070,685 (GRCm39) missense probably damaging 1.00
R9732:Usb1 UTSW 8 96,065,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCAAGTTCGAGGCCAAC -3'
(R):5'- GTTAGGCAGTCCATTGTCTCC -3'

Sequencing Primer
(F):5'- CCAACATGGCAAGACTGGTGTG -3'
(R):5'- GGCAGTCCATTGTCTCCTCAGG -3'
Posted On 2020-01-23