Incidental Mutation 'R8039:Usb1'
ID618416
Institutional Source Beutler Lab
Gene Symbol Usb1
Ensembl Gene ENSMUSG00000031792
Gene NameU6 snRNA biogenesis 1
SynonymsAA960436
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95332284-95347507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95333413 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 50 (S50R)
Ref Sequence ENSEMBL: ENSMUSP00000034245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034245] [ENSMUST00000057717] [ENSMUST00000126180] [ENSMUST00000213059]
Predicted Effect probably damaging
Transcript: ENSMUST00000034245
AA Change: S50R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034245
Gene: ENSMUSG00000031792
AA Change: S50R

DomainStartEndE-ValueType
Pfam:HVSL 45 265 6.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057717
SMART Domains Protein: ENSMUSP00000053397
Gene: ENSMUSG00000046556

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Blast:ZnF_C2H2 75 99 6e-7 BLAST
ZnF_C2H2 103 123 7.57e1 SMART
ZnF_C2H2 131 153 8.67e-1 SMART
low complexity region 168 189 N/A INTRINSIC
ZnF_C2H2 201 223 9.73e-4 SMART
ZnF_C2H2 229 251 1.47e-3 SMART
ZnF_C2H2 257 279 1.12e-3 SMART
ZnF_C2H2 314 336 6.42e-4 SMART
ZnF_C2H2 342 364 1.2e-3 SMART
ZnF_C2H2 370 392 8.81e-2 SMART
ZnF_C2H2 398 418 2.75e1 SMART
ZnF_C2H2 427 449 1.84e-4 SMART
ZnF_C2H2 457 477 1.27e2 SMART
ZnF_C2H2 485 507 2.79e-4 SMART
ZnF_C2H2 513 535 6.42e-4 SMART
ZnF_C2H2 541 563 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126180
SMART Domains Protein: ENSMUSP00000122529
Gene: ENSMUSG00000031792

DomainStartEndE-ValueType
Pfam:HVSL 1 113 6.4e-36 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213059
AA Change: V44E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Usb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03164:Usb1 APN 8 95333484 missense probably damaging 1.00
R0276:Usb1 UTSW 8 95333457 missense probably damaging 1.00
R0385:Usb1 UTSW 8 95345318 missense probably damaging 1.00
R0730:Usb1 UTSW 8 95344041 missense probably damaging 1.00
R0801:Usb1 UTSW 8 95333540 splice site probably null
R1497:Usb1 UTSW 8 95338697 missense probably benign 0.00
R2230:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2231:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2232:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2402:Usb1 UTSW 8 95343131 missense probably benign 0.06
R2507:Usb1 UTSW 8 95343124 missense probably damaging 1.00
R3821:Usb1 UTSW 8 95333433 missense probably benign 0.35
R5085:Usb1 UTSW 8 95344051 missense probably damaging 0.98
R5834:Usb1 UTSW 8 95333533 utr 3 prime probably benign
R7398:Usb1 UTSW 8 95345303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCAAGTTCGAGGCCAAC -3'
(R):5'- GTTAGGCAGTCCATTGTCTCC -3'

Sequencing Primer
(F):5'- CCAACATGGCAAGACTGGTGTG -3'
(R):5'- GGCAGTCCATTGTCTCCTCAGG -3'
Posted On2020-01-23