Incidental Mutation 'R8039:Fbxo31'
ID618417
Institutional Source Beutler Lab
Gene Symbol Fbxo31
Ensembl Gene ENSMUSG00000052934
Gene NameF-box protein 31
Synonyms1110003O08Rik, Fbx14, Fbxo14, 2310046N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121549440-121578806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121559055 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 219 (T219S)
Ref Sequence ENSEMBL: ENSMUSP00000057573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059018] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000059018
AA Change: T219S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057573
Gene: ENSMUSG00000052934
AA Change: T219S

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
low complexity region 358 379 N/A INTRINSIC
low complexity region 385 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212985
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the F-box family. Members are classified into three classes according to the substrate interaction domain, FBW for WD40 repeats, FBL for leucing-rich repeats, and FBXO for other domains. This protein, classified into the last category because of the lack of a recognizable substrate binding domain, has been proposed to be a component of the SCF ubiquitination complex. It is thought to bind and recruit substrate for ubiquitination and degradation. This protein may have a role in regulating the cell cycle as well as dendrite growth and neuronal migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Fbxo31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Fbxo31 APN 8 121554330 missense possibly damaging 0.92
IGL02155:Fbxo31 APN 8 121559075 missense probably damaging 1.00
IGL02551:Fbxo31 APN 8 121566344 missense probably damaging 0.99
IGL03092:Fbxo31 APN 8 121560018 missense probably benign
R0377:Fbxo31 UTSW 8 121559102 unclassified probably benign
R0730:Fbxo31 UTSW 8 121555364 unclassified probably benign
R1132:Fbxo31 UTSW 8 121552276 frame shift probably null
R1132:Fbxo31 UTSW 8 121552280 frame shift probably null
R1626:Fbxo31 UTSW 8 121560006 missense probably damaging 1.00
R1796:Fbxo31 UTSW 8 121560438 nonsense probably null
R2215:Fbxo31 UTSW 8 121566311 missense probably benign 0.01
R3726:Fbxo31 UTSW 8 121578509 missense probably damaging 1.00
R3761:Fbxo31 UTSW 8 121560430 missense possibly damaging 0.94
R4646:Fbxo31 UTSW 8 121560016 missense probably benign
R4782:Fbxo31 UTSW 8 121552439 nonsense probably null
R4782:Fbxo31 UTSW 8 121552441 missense probably damaging 1.00
R5103:Fbxo31 UTSW 8 121552362 missense probably damaging 1.00
R5715:Fbxo31 UTSW 8 121578563 missense probably damaging 1.00
R6347:Fbxo31 UTSW 8 121578459 missense possibly damaging 0.69
R6551:Fbxo31 UTSW 8 121564704 intron probably benign
R7027:Fbxo31 UTSW 8 121578485 missense probably damaging 1.00
R7156:Fbxo31 UTSW 8 121554321 missense possibly damaging 0.83
R7271:Fbxo31 UTSW 8 121578764 unclassified probably benign
R7594:Fbxo31 UTSW 8 121552368 missense probably damaging 1.00
R7860:Fbxo31 UTSW 8 121564645 splice site probably null
R8116:Fbxo31 UTSW 8 121560388 missense probably damaging 1.00
R8284:Fbxo31 UTSW 8 121560442 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCCACCATTCCAAACGATG -3'
(R):5'- AAGTTATGTACCCTAGCCCTCC -3'

Sequencing Primer
(F):5'- AACGATGGGCCCTCACATG -3'
(R):5'- AGACAGTTCACTAGGTTGCC -3'
Posted On2020-01-23