Incidental Mutation 'R8039:Nphp3'
ID618421
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8039 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104031963 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 791 (S791P)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774]
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: S791P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: S791P

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194183
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: S671P
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: S671P

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vmn2r99 T C 17: 19,380,040 I442T probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 intron probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGAGACAAAGTCTAGGTAAAACC -3'
(R):5'- GTGTTGGACAGGTTTCACATGC -3'

Sequencing Primer
(F):5'- GCCTCATCAACGTTAGTC -3'
(R):5'- GGACAGGTTTCACATGCAATTTAAAG -3'
Posted On2020-01-23