Incidental Mutation 'R0661:Cpne2'
ID61843
Institutional Source Beutler Lab
Gene Symbol Cpne2
Ensembl Gene ENSMUSG00000034361
Gene Namecopine II
Synonyms
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0661 (G1)
Quality Score98
Status Not validated
Chromosome8
Chromosomal Location94532990-94570531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94556039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 283 (I283T)
Ref Sequence ENSEMBL: ENSMUSP00000045755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048653] [ENSMUST00000109537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048653
AA Change: I283T

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045755
Gene: ENSMUSG00000034361
AA Change: I283T

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 507 7.26e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109537
AA Change: I283T

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105163
Gene: ENSMUSG00000034361
AA Change: I283T

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 506 8.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212550
AA Change: I54T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Cpne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cpne2 APN 8 94554753 missense possibly damaging 0.84
IGL02702:Cpne2 APN 8 94570023 missense probably benign 0.03
IGL03277:Cpne2 APN 8 94548372 missense probably benign 0.00
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0126:Cpne2 UTSW 8 94554933 missense probably damaging 1.00
R0135:Cpne2 UTSW 8 94554925 unclassified probably benign
R0167:Cpne2 UTSW 8 94568579 unclassified probably benign
R0671:Cpne2 UTSW 8 94548342 start gained probably benign
R4691:Cpne2 UTSW 8 94558221 missense probably damaging 0.99
R4856:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R4886:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R6632:Cpne2 UTSW 8 94554955 missense probably benign 0.00
R6699:Cpne2 UTSW 8 94563959 missense probably damaging 0.99
R6968:Cpne2 UTSW 8 94548502 missense probably damaging 1.00
R7117:Cpne2 UTSW 8 94555544 missense probably damaging 1.00
R7505:Cpne2 UTSW 8 94548466 missense possibly damaging 0.90
R7571:Cpne2 UTSW 8 94551780 missense probably benign
R7583:Cpne2 UTSW 8 94555581 missense probably benign
R7612:Cpne2 UTSW 8 94557420 missense probably benign 0.01
R7745:Cpne2 UTSW 8 94568684 missense probably damaging 1.00
R7845:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R7928:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R8278:Cpne2 UTSW 8 94554688 missense probably damaging 1.00
R8319:Cpne2 UTSW 8 94553412 missense probably benign 0.01
X0025:Cpne2 UTSW 8 94557451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCAGGATGTTGGACCAAGCAG -3'
(R):5'- TCTACAGTGTAAGCCTCCACGGAAG -3'

Sequencing Primer
(F):5'- gcactcaatcacacctctcc -3'
(R):5'- CCTCCACGGAAGAGGGAAC -3'
Posted On2013-07-30