Incidental Mutation 'R8039:Vmn2r99'
ID 618444
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R8039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19361949-19401098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19380040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 442 (I442T)
Ref Sequence ENSEMBL: ENSMUSP00000135236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: I442T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: I442T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: I442T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,943,214 V1140E probably benign Het
Abca17 T C 17: 24,328,725 H225R probably damaging Het
Adgrb2 T A 4: 130,022,268 L1451Q probably damaging Het
Afdn T C 17: 13,899,141 L1713P probably damaging Het
Agr2 A T 12: 35,995,559 I15F probably benign Het
Agrn T C 4: 156,169,011 T1808A probably benign Het
Akap6 A G 12: 53,141,676 I1958V probably benign Het
Ankrd60 C A 2: 173,572,491 probably null Het
Anpep A G 7: 79,839,400 probably null Het
Apoa4 A T 9: 46,242,293 D64V possibly damaging Het
Arhgef26 C A 3: 62,339,930 T145N probably benign Het
Art1 A T 7: 102,106,845 Q81L probably benign Het
Astl A T 2: 127,343,983 S71C probably damaging Het
Atp2a1 A G 7: 126,448,805 I611T probably damaging Het
Cacna2d2 T A 9: 107,527,433 V1139D possibly damaging Het
Chst10 T A 1: 38,866,031 K198* probably null Het
Ckmt2 G A 13: 91,863,312 H60Y possibly damaging Het
Coq7 G C 7: 118,533,246 S2R possibly damaging Het
Cspp1 T A 1: 10,113,013 D814E probably benign Het
Cyp2c54 CCTCTTTCATAGCTCT CCTCT 19: 40,073,732 probably null Het
Daam2 C A 17: 49,464,538 G860V probably damaging Het
Ecm2 A T 13: 49,514,850 I10F probably benign Het
Epb41l1 A T 2: 156,506,412 D312V probably damaging Het
Epsti1 G A 14: 77,931,301 R126H probably damaging Het
Erc1 A T 6: 119,773,665 Y367* probably null Het
Erh T A 12: 80,637,578 R42W probably damaging Het
Fam124a C T 14: 62,605,876 Q278* probably null Het
Fam155a T C 8: 9,207,892 T419A probably benign Het
Fbxo3 T A 2: 104,054,941 L385Q probably damaging Het
Fbxo31 T A 8: 121,559,055 T219S probably damaging Het
Fstl5 T G 3: 76,648,418 V534G possibly damaging Het
Gatsl3 G T 11: 4,221,639 A288S probably damaging Het
Gbp2b A T 3: 142,618,164 I577F probably benign Het
Gbp8 A T 5: 105,050,917 L44* probably null Het
Gck C T 11: 5,910,301 A114T probably benign Het
Gm16486 T C 8: 70,710,906 V916A probably benign Het
Gtf2i A G 5: 134,255,834 V537A possibly damaging Het
Iqcm C A 8: 75,763,105 H400Q probably damaging Het
Itpr1 T C 6: 108,386,628 L737P probably damaging Het
Jakmip1 A G 5: 37,100,772 E254G probably damaging Het
Kif15 A T 9: 123,007,425 R1095W possibly damaging Het
Klhdc8a G A 1: 132,303,108 R237Q probably benign Het
Klhl38 T C 15: 58,322,862 E157G probably benign Het
Klrk1 T A 6: 129,612,823 N221I probably benign Het
Lhx8 A T 3: 154,306,939 H345Q probably damaging Het
Lims1 T A 10: 58,409,672 N174K probably benign Het
Madd T A 2: 91,167,061 Q754L probably benign Het
Mau2 T C 8: 70,019,790 D581G probably damaging Het
Miga1 A T 3: 152,276,756 I561N probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3c T C 4: 115,831,687 V139A probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Ncapd2 C T 6: 125,181,026 V380I probably damaging Het
Nes G A 3: 87,977,008 R858K probably benign Het
Nphp3 T C 9: 104,031,963 S791P probably benign Het
Nup210 T C 6: 91,070,233 T496A probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 C T 2: 88,525,871 T96I probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr914 T A 9: 38,607,389 M308K probably benign Het
Ovgp1 T A 3: 105,976,023 S105T probably benign Het
Pbld2 T A 10: 63,047,992 C79S probably damaging Het
Pik3cd T A 4: 149,659,866 M143L possibly damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppp1r11 T C 17: 36,951,446 T21A probably damaging Het
Prpf8 T A 11: 75,502,542 I1664N possibly damaging Het
Prr29 C T 11: 106,376,912 A161V probably benign Het
Rasa3 T C 8: 13,588,931 D292G probably damaging Het
Rnf25 T C 1: 74,593,964 T411A probably damaging Het
Rraga C T 4: 86,575,980 T21I probably damaging Het
Setdb2 T A 14: 59,402,375 Y673F probably damaging Het
Sf3a1 C T 11: 4,167,787 T183I probably damaging Het
Shank3 A T 15: 89,505,439 H413L probably damaging Het
Slc30a5 A G 13: 100,813,681 probably null Het
Slc6a18 T C 13: 73,665,626 S523G probably benign Het
Spaca1 C T 4: 34,044,207 V96I probably damaging Het
Sycp2 C T 2: 178,374,585 A695T probably benign Het
Tnrc18 C A 5: 142,732,052 G2216C unknown Het
Trak2 T C 1: 58,946,288 N17S probably benign Het
Ttn T A 2: 76,878,432 N8792I unknown Het
Ttyh1 T C 7: 4,122,541 V64A probably benign Het
Usb1 T A 8: 95,333,413 S50R probably damaging Het
Ush2a T A 1: 188,957,373 I5044N probably damaging Het
Vmn1r84 A T 7: 12,362,008 F253I possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19393817 missense possibly damaging 0.91
R8493:Vmn2r99 UTSW 17 19393758 missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19394181 missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19393660 critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19378126 nonsense probably null
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCAAAGGAGTCTTGTTAGGTTTC -3'
(R):5'- TTCTGGCCATTGGATCATCTG -3'

Sequencing Primer
(F):5'- AGATCAGTTGTCATTGAGTGTTTAC -3'
(R):5'- GCCATTGGATCATCTGTTCAG -3'
Posted On 2020-01-23