Incidental Mutation 'R0661:Slc26a6'
ID61845
Institutional Source Beutler Lab
Gene Symbol Slc26a6
Ensembl Gene ENSMUSG00000023259
Gene Namesolute carrier family 26, member 6
SynonymsPat1, B930010B04Rik, CFEX
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0661 (G1)
Quality Score119
Status Not validated
Chromosome9
Chromosomal Location108853283-108913049 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 108859113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098376] [ENSMUST00000098376] [ENSMUST00000188557] [ENSMUST00000188557] [ENSMUST00000192507] [ENSMUST00000192559] [ENSMUST00000193291] [ENSMUST00000193291] [ENSMUST00000193874]
Predicted Effect probably null
Transcript: ENSMUST00000098376
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098376
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188557
SMART Domains Protein: ENSMUSP00000140849
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188557
SMART Domains Protein: ENSMUSP00000140849
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192507
SMART Domains Protein: ENSMUSP00000141336
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192559
SMART Domains Protein: ENSMUSP00000141632
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193291
SMART Domains Protein: ENSMUSP00000142250
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193291
SMART Domains Protein: ENSMUSP00000142250
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193825
Predicted Effect probably benign
Transcript: ENSMUST00000193874
SMART Domains Protein: ENSMUSP00000141409
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 7.7e-34 PFAM
Pfam:Sulfate_transp 176 225 1.8e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195646
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 26 family, whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting chloride, oxalate, sulfate and bicarbonate. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display abnormal proximal tubule and duodenal anion exchange, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Slc26a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Slc26a6 APN 9 108855889 missense probably benign
IGL02447:Slc26a6 APN 9 108857052 missense probably benign 0.03
IGL03090:Slc26a6 APN 9 108860691 missense probably benign 0.06
R0018:Slc26a6 UTSW 9 108858922 splice site probably null
R0083:Slc26a6 UTSW 9 108859113 splice site probably null
R0133:Slc26a6 UTSW 9 108861323 missense possibly damaging 0.86
R0135:Slc26a6 UTSW 9 108860595 splice site probably benign
R0563:Slc26a6 UTSW 9 108857670 missense probably damaging 1.00
R1513:Slc26a6 UTSW 9 108855836 missense probably benign 0.41
R1746:Slc26a6 UTSW 9 108861717 missense probably benign 0.00
R2079:Slc26a6 UTSW 9 108859058 missense probably damaging 0.97
R2939:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R2940:Slc26a6 UTSW 9 108857037 missense probably benign 0.05
R3833:Slc26a6 UTSW 9 108855918 missense possibly damaging 0.86
R3861:Slc26a6 UTSW 9 108854196 unclassified probably benign
R4175:Slc26a6 UTSW 9 108854217 unclassified probably benign
R4358:Slc26a6 UTSW 9 108861783 missense probably benign 0.00
R4403:Slc26a6 UTSW 9 108855938 missense probably benign
R4598:Slc26a6 UTSW 9 108856380 missense probably damaging 1.00
R4660:Slc26a6 UTSW 9 108861341 missense probably damaging 0.96
R4663:Slc26a6 UTSW 9 108857907 missense probably damaging 0.98
R5296:Slc26a6 UTSW 9 108860646 missense probably damaging 1.00
R5390:Slc26a6 UTSW 9 108861300 splice site probably benign
R5533:Slc26a6 UTSW 9 108857956 missense probably damaging 1.00
R5662:Slc26a6 UTSW 9 108859339 missense possibly damaging 0.94
R5845:Slc26a6 UTSW 9 108862083 missense possibly damaging 0.46
R6547:Slc26a6 UTSW 9 108860782 intron probably null
R7079:Slc26a6 UTSW 9 108857948 missense probably damaging 1.00
R7652:Slc26a6 UTSW 9 108855944 critical splice donor site probably null
R8289:Slc26a6 UTSW 9 108856031 missense probably benign 0.00
R8290:Slc26a6 UTSW 9 108856031 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTCAGCAACCCTGATGACATTCC -3'
(R):5'- AATATCCGTATCTGGCACCTGCCC -3'

Sequencing Primer
(F):5'- GCTCTCTTTGGAAGGCAAAC -3'
(R):5'- AAGCTGTGCTTGTGAAGAGC -3'
Posted On2013-07-30