Incidental Mutation 'R8040:Ccl19'
ID618460
Institutional Source Beutler Lab
Gene Symbol Ccl19
Ensembl Gene ENSMUSG00000071005
Gene Namechemokine (C-C motif) ligand 19
Synonymsexodus-3, Scya19, CKb11
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8040 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location42754525-42756577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42756297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 12 (S12G)
Ref Sequence ENSEMBL: ENSMUSP00000100022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068158] [ENSMUST00000102957] [ENSMUST00000107984] [ENSMUST00000140546]
Predicted Effect probably benign
Transcript: ENSMUST00000068158
SMART Domains Protein: ENSMUSP00000068585
Gene: ENSMUSG00000054885

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102957
AA Change: S12G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100022
Gene: ENSMUSG00000071005
AA Change: S12G

DomainStartEndE-ValueType
SCY 30 90 5.21e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107984
SMART Domains Protein: ENSMUSP00000103618
Gene: ENSMUSG00000054885

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140546
AA Change: S12G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144891
Gene: ENSMUSG00000071005
AA Change: S12G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCY 30 90 2.6e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in reduced T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,715,035 D675V probably benign Het
Adam21 T C 12: 81,560,437 R184G probably benign Het
Adcy10 A G 1: 165,552,024 K952E probably damaging Het
Allc A T 12: 28,555,352 I316N probably damaging Het
Ano8 T C 8: 71,482,168 T432A probably benign Het
Cadps2 C A 6: 23,412,943 probably benign Het
Camsap2 T C 1: 136,281,247 S168G Het
Cltc A G 11: 86,725,205 S412P probably damaging Het
Cwc25 A G 11: 97,750,870 probably null Het
Cxcr4 A G 1: 128,589,798 F42S probably damaging Het
Cyp4a12a A G 4: 115,326,215 Q177R probably benign Het
Dnal4 T C 15: 79,761,968 T112A probably benign Het
Dock9 C A 14: 121,651,794 G304C probably benign Het
Evpl T C 11: 116,222,932 T1311A probably damaging Het
Fat4 T C 3: 38,981,666 Y3156H probably damaging Het
Golgb1 A G 16: 36,913,479 I1070M possibly damaging Het
Hcls1 A G 16: 36,951,149 D139G probably damaging Het
Ighv1-7 A G 12: 114,538,770 S26P probably benign Het
Il1r1 A T 1: 40,313,349 T563S probably benign Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnk4 A G 19: 6,927,627 Y219H probably damaging Het
Kcnt2 G A 1: 140,450,217 A403T probably damaging Het
Maats1 A G 16: 38,320,371 S407P possibly damaging Het
Mdp1 T A 14: 55,660,066 N44I probably benign Het
Nceh1 A G 3: 27,241,225 N212D probably benign Het
Nynrin G A 14: 55,871,525 G1363D probably benign Het
Olfr1165-ps T A 2: 88,101,359 R209S unknown Het
Olfr26 T A 9: 38,855,164 I34N probably damaging Het
Olfr429 T C 1: 174,089,157 I39T possibly damaging Het
Olfr986 A G 9: 40,187,421 H102R probably damaging Het
Papd7 A G 13: 69,500,481 Y719H probably damaging Het
Parp2 T A 14: 50,810,173 M47K probably benign Het
Pfdn6 T C 17: 33,939,977 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plb1 T A 5: 32,273,069 H123Q possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Prodh2 A G 7: 30,506,411 D238G probably damaging Het
Rad51ap2 T A 12: 11,458,791 S905T probably benign Het
Sclt1 C T 3: 41,657,376 R487H probably damaging Het
Serpina3b A G 12: 104,131,076 I205M probably benign Het
Sowahb A G 5: 93,043,433 S476P possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tnxb T C 17: 34,716,558 Y2611H probably damaging Het
Uggt1 T C 1: 36,211,473 E237G possibly damaging Het
Vmn1r87 T A 7: 13,132,159 Y67F possibly damaging Het
Vmn2r107 G A 17: 20,375,546 C787Y probably damaging Het
Zscan4-ps3 T A 7: 11,612,673 I212N probably damaging Het
Other mutations in Ccl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4564:Ccl19 UTSW 4 42756295 missense probably damaging 1.00
R5049:Ccl19 UTSW 4 42756268 critical splice donor site probably null
R6988:Ccl19 UTSW 4 42754885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACATTGGAATCCTGG -3'
(R):5'- ACTTGCACTTGGCTCCTGAAC -3'

Sequencing Primer
(F):5'- GGCACATTCATATTGACAGGC -3'
(R):5'- GGCTCCTGAACCCCTTCACG -3'
Posted On2020-01-23