Incidental Mutation 'R0661:Shroom1'
ID61847
Institutional Source Beutler Lab
Gene Symbol Shroom1
Ensembl Gene ENSMUSG00000018387
Gene Nameshroom family member 1
SynonymsShrm1, Apx, 1300007L22Rik
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0661 (G1)
Quality Score168
Status Not validated
Chromosome11
Chromosomal Location53457205-53467766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53466937 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 772 (S772P)
Ref Sequence ENSEMBL: ENSMUSP00000104641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000057722] [ENSMUST00000093114] [ENSMUST00000109013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018531
AA Change: S709P

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387
AA Change: S709P

DomainStartEndE-ValueType
Pfam:ASD1 108 269 1.1e-21 PFAM
low complexity region 410 417 N/A INTRINSIC
Pfam:ASD2 454 732 4.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057722
Predicted Effect probably benign
Transcript: ENSMUST00000093114
SMART Domains Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387

DomainStartEndE-ValueType
Pfam:ASD1 108 269 3.7e-22 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 517 715 1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109010
Predicted Effect possibly damaging
Transcript: ENSMUST00000109013
AA Change: S772P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: S772P

DomainStartEndE-ValueType
Pfam:ASD1 114 269 4.2e-19 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 518 795 2.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155297
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Shroom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Shroom1 APN 11 53464094 missense probably benign 0.00
IGL00985:Shroom1 APN 11 53465969 missense probably benign
IGL01111:Shroom1 APN 11 53464048 missense probably damaging 0.98
IGL01316:Shroom1 APN 11 53465558 missense probably damaging 0.99
IGL02512:Shroom1 APN 11 53466559 missense probably damaging 1.00
IGL03062:Shroom1 APN 11 53463379 missense probably benign
R0083:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0357:Shroom1 UTSW 11 53465208 missense probably damaging 0.96
R1875:Shroom1 UTSW 11 53465675 missense probably damaging 0.99
R2356:Shroom1 UTSW 11 53466447 missense probably benign 0.05
R4657:Shroom1 UTSW 11 53465588 missense possibly damaging 0.79
R4662:Shroom1 UTSW 11 53466462 missense possibly damaging 0.64
R4690:Shroom1 UTSW 11 53465722 missense possibly damaging 0.91
R4734:Shroom1 UTSW 11 53465233 missense probably damaging 1.00
R4820:Shroom1 UTSW 11 53465139 missense probably benign 0.07
R4964:Shroom1 UTSW 11 53465172 missense probably benign
R5000:Shroom1 UTSW 11 53467117 utr 3 prime probably benign
R5046:Shroom1 UTSW 11 53464045 missense probably benign 0.00
R5141:Shroom1 UTSW 11 53463982 nonsense probably null
R5256:Shroom1 UTSW 11 53465507 missense probably benign 0.32
R5273:Shroom1 UTSW 11 53463844 missense possibly damaging 0.82
R5529:Shroom1 UTSW 11 53463922 missense probably damaging 1.00
R5762:Shroom1 UTSW 11 53463991 missense probably benign 0.00
R6058:Shroom1 UTSW 11 53463481 missense possibly damaging 0.83
R6408:Shroom1 UTSW 11 53463387 missense probably benign 0.00
R6677:Shroom1 UTSW 11 53463516 missense possibly damaging 0.85
R7090:Shroom1 UTSW 11 53465933 missense probably damaging 1.00
R7369:Shroom1 UTSW 11 53465248 missense probably benign 0.43
R7654:Shroom1 UTSW 11 53466908 missense probably benign 0.02
R7919:Shroom1 UTSW 11 53463393 missense probably benign 0.17
R7964:Shroom1 UTSW 11 53464322 missense possibly damaging 0.94
R8338:Shroom1 UTSW 11 53463280 missense probably benign 0.08
R8365:Shroom1 UTSW 11 53465641 nonsense probably null
R8386:Shroom1 UTSW 11 53466403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACAGCGACCCTGATGAGAGG -3'
(R):5'- TAAAGCATCGCCCCAGTTGTGG -3'

Sequencing Primer
(F):5'- AAGCAACGGTGTTCACTGC -3'
(R):5'- CCTGGGACAATGTTCCCAC -3'
Posted On2013-07-30